GenePrediction:GLEAN_3335 Details

Name: GLEAN_3335
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:715154..717205 (+ strand)
Length: 2052
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:715154..715361 (+ strand)
Length: 208
Type: CDS
Source: GLEAN
Position: GCSC_89:715444..715534 (+ strand)
Length: 91
Type: CDS
Source: GLEAN
Position: GCSC_89:715599..715753 (+ strand)
Length: 155
Type: CDS
Source: GLEAN
Position: GCSC_89:715833..716045 (+ strand)
Length: 213
Type: CDS
Source: GLEAN
Position: GCSC_89:716100..716233 (+ strand)
Length: 134
Type: CDS
Source: GLEAN
Position: GCSC_89:716314..716540 (+ strand)
Length: 227
Type: CDS
Source: GLEAN
Position: GCSC_89:716604..716675 (+ strand)
Length: 72
Type: CDS
Source: GLEAN
Position: GCSC_89:716733..716798 (+ strand)
Length: 66
Type: CDS
Source: GLEAN
Position: GCSC_89:716866..717205 (+ strand)
Length: 340
>GLEAN_3335 class=GenePrediction position=GCSC_89:715154..717205 (+ strand)
ATGGCTGACAGAAAGGACGCTGAAGCTGCTGTGGGAGTGCCCGAAGACGTGCTGCCTGTAGCCTACGAAGACGAGGCGTC
GGAAGACAACAATGCCGTCCGGATGGTCGAGATCCCCGGCAACAAATGGCTGAGGAGATACCGAAGCGTGGCTTTCCAGA
TGATTGCCATGGCCTTGCTCGCATTTTCCGGCCCGTCCATGAGCAATGGTATGTGGAGGCGACCACTCCTAGCTACGAGC
TTCGTGCTCTCTCTCTCGTTCGCATCGCTGACTCTCGTCATCCGCTTCAGCCATCAGTGGCCTCGGAGGAGGCGGTCTTG
CCACTCCGTACACGGCCAACGCGGCATCTGCCACGCAATATTCAACATCTGCCCTGATCGCGTCAGTAGCCTTCTCGTCT
TCGCAGCCTCCTCCAGTTGTCAAACTCACCATCTCTCTGTCATAGTCTGTTCGGTGGCCCCATCGTCAGCGCCATTGGCA
TCCCTGCCGCCTGCATGATAGGTGGTGTTGGCTTTCCTCTGTCGGGCTCTGGCTTTTATGTCAATAGCAAATACGGCGTC
CAGTGGTATCTGATTTTTGCAAAGGCGCTGTACGGCATCAGTCAGTAGAGCCCTCCTTTCTCGACATCCCTCGCTGCAAT
GACAAAAGTGATAGTGACTAATTGTCGTGTTTCTACTAGCTTCTGCCTTCCTGTATATCGCCGAAGCTGCGACTATGATC
TCCTATCCCGAAGAGCACCGCCGGGGCTTTTACATCAGCATATGGGTGGCCATGCGCAACGTTGGATCAATCATTGGAGG
GGCCATCACCTTGGGTCTGAATATCAAGAGAAAGGGAGGTGGCGGGGTGTCAACGAACACGTACTTGGTGTTTCTTGGCT
TGGAATGCATCGGTAAGCCAAGCGAGCACTGGCTACTTTGTGCAACCACAAATCTGACTTCCCTAGGTCTACCTTCTGCA
CTGCTCCTAACCAAAACCCGCAAGGTCATCCGGTCTGATGGCTGGGGCGTTCCCATGCTCCCTAAAAAGTCGTGGAAACG
AGAAGTTGTGCTGCTATGGGAACATCATAAGCAGAAGCGGGTATACTACCACCTTTCTACTGCACTCGTCCCGTTTTCTC
TCTCCTGTCTTTGTTTGTATTTTCTGACATAGCCAATCAGACCTTGATGTTGGTTCCCATCTACATGTTGACATACTTTG
GGGACGGTGTCTGGGGAACCTACGCCTCGAAACACTACTCCGTCCGTGCTCGAGCACTTTCCAACTTTGTCGGCCCTTGT
TTGGCTGTTCTTATAAACCCGCTTTTTGGCAAGATCCTGGATATGAAGAATGTTCGCCCGAGAACCAAAGGCATGATTGG
GTTCTGGGTCTGGACTCTTCCATCAGCGTAAGCTACTACCAGCGGATGGTTTTATCTAAATTCGGCTGTTTTATACTGAC
CACCGCCTAGAGCTATGCTCATATGGGTGATGATCAATCTCAAGTGGTTTGAAGGTCAGCCTAGCAGCCTTCGCCTAGAC
TAGTAAGTCACGTCATCGACTTGCGAGTAATACTACACAGACATACTGACCAATTTCAGCGCTCAACCTACGACTGCCCG
ATGGGTGAGGGCTTGGTTCCCACATCTGATCTACGTCGTCAACGGGTAAGTATTTTTACTTTCATGCTTGTTGTTGCCAC
TTGCCAAGGCTATCTGTGCTAACTTGTCCCAGTTGGATGTCTCAAACTCTTGTCTATTGGATCTTGGGCCAGTTCGCCTC
CGATGTCGCTACAAATGCACGTACCGGTGGTGTGTTTCGCTGCTGGGAGACTGTCGGCCAAGCCGTGTCGTACGGTATCA
ACGCAAAGGCATCCAACAAGTTTATCCCATTTGGCATCTACATCGGCCTGTTCATAATTGCCGTTCCTCTTCTCTGGCTG
ATCGTCCTGGAGCTACCGACTGAGAAGAGAGTGGTTAGAGTGATTGACGACGAAGGGAACGCGGTTGGCGATCTTGGCAC
CGTGAAGCCTACTCTAGTAGAAGAGAATTCGACACGAGACGGTTCGCTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62