GenePrediction:GLEAN_3336 Details

Name: GLEAN_3336
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:718016..720567 (+ strand)
Length: 2552
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:718016..718422 (+ strand)
Length: 407
Type: CDS
Source: GLEAN
Position: GCSC_89:718549..719384 (+ strand)
Length: 836
Type: CDS
Source: GLEAN
Position: GCSC_89:719450..720014 (+ strand)
Length: 565
Type: CDS
Source: GLEAN
Position: GCSC_89:720096..720220 (+ strand)
Length: 125
Type: CDS
Source: GLEAN
Position: GCSC_89:720281..720567 (+ strand)
Length: 287
>GLEAN_3336 class=GenePrediction position=GCSC_89:718016..720567 (+ strand)
ATGGGCCCCAGCCGGCTCGAAGACGAGGAGCTCTCCATTTCGTTGCCACGCTCTCAGAGCCGCCGCTCCCATACCACGCT
GGCTTCCGGCCAGCCTCCGCCGCAGGTCAGCGTCACCGACTATGGCGCCGTCGATGATGCCAAGGGCCAGGGCAAGACCG
GCACTCCCACGCATCTCCCCGACCGCATAAAGTCTACCGATGCCCGGCTCGACCAGTACAATGTCATCCGTACCTTGGGC
GAGGGCTCCTTCGGCAAGGTCAAGCTTGCCATTCACAAATCGACAGGCCAGAAAGTAGCCCTCAAGATCATCTCGCGCAA
AAAGCTCATCAGCCGCGACATGACCGGTCGTGTTGAACGCGAGATCGAGTTCTTACAGCTTCTGCGTCATCCCCACATCA
TCAAGCTGTGTGTACAGGTCTTTTTTCTCTTCCCATCCCTGACAGTCTCCATTGCCGCACAGCTTCAACTCCGTCCATGT
CCATGCTTTCAGGCCTCCCCACGCTCACGATGCTGACAACCATGTCTGCCCAGGTACACCGTCATCAAAGACTCGAACGA
TATCATTATGGTCCTCGAATATGCCGGTGGTGAGCTGTTCGACTACATCGTCAAGAAAGGCCGCATGACAGAGCCCGAAG
CTCGGCGTTTCTTCCAGCAGATGCTGTGCGCCGTCGAATATTGCCATCGCTACCGTGTTGTGCACCGCGACCTCAAGCCC
GAGAACCTGCTCCTCGATGATAAACTGAACGTCAAGATCGCCGATTTCGGTCTCAGCAATATCATGACAGACGGCAACTT
CCTCAAGACCAGCTGTGGCAGTCCCAACTATGCCGCCCCGGAAGTCATCAATGGCAAACTCTATGCTGGCCCCGAGGTGG
ATGTTTGGAGTTGCGGCGTCATTTTGTACGTCCTGCTCGTCGGCCGCCTACCCTTCGATGACGACCACATCCCCAGCTTG
TTTGCCAAGATCGCCAAGGGGGCGTATATTTTACCCTCGTGGATGAGCCCTGGTGCGGCCGGCCTGATCAAGAAGATGCT
TGTCGTCAACCCCGTTCAACGTGCGACCATTGAGGAGATCCGGCAGGACCCTTGGTTCCTGGCTGATTTGCCCGACTACC
TGAAGCCCCCGGCCGAACCCTTCTTGAACACGGGCATTGATCCGGATAAGGCGATCAGACCCAGCGACATTGCACCACAT
GCATCTGCCAAGGTACAAGAGAAGCTTCACGACGAGGTGACCGAGAAGATCTCAAAGACAATGGGGTATGGAAGGAAGGA
CGTCCAGGAGGCGTTAGAGGCCAACGTGCCTTCTGCCATCAAGGATGCATACATGATTGTTCGGGATAACAAGCTTATGC
AGATCAACCGTGAGCCGCCACCCCCTTGGGAAACATCTTGGCACCCGAAACTACTTGCTAACAAGCTCGAATAGCGACTC
TAGGCGCCGACAACCCGTACTTTGCATCGTCACCAACAGAGAACACGACCTCCAGCTCCATCGCCATGAACATGGCAGGA
AGTGGTGAGCTAGATCCCGGCGCCAGCCCTCTGGGCATGTCATCTAGCCGGTCTATCAACTCGAACAGCACGAGCGCCTC
GCCAAGGCCTTACGTCTCAAAAGTCGGCGTTCTTCCTAGTAGCTTGCCGGCCTACCACAAGGATTACATGGCTGGCAGCG
GGAACATCATGGAGACCCCCTCCTTTGCCGACCCGCCTGCAGCAACACGAACATTGGCCGATCAAGAGGAAACATCTCGC
CGCCTGCGTCCTCACTCCCGCAGCCAGATCCGCCTCGACGAGTCCAGCATGAGACCGCAGGGTATGACGCCGGTCAATCC
TCCTAAGAAGTCCAAGCAGGTGCGGTGGCAATTTGGCATCCGGTCGAGGAATGTGGCGTGGGACGCTCTGCTCTGCATTT
ACAAGGCATTGAACCGACTGGGCTGCAGTTGGGTTGTCGACGAAGACTTCAACAAGTACAGTAACGAAGAGGACGATAAG
TGTGTTACAGCCCCTCGGACAACCACTCTCACGGTGCATGTAGTATGTCCTGTTGTGCTAACTTGTGGAAGTCGATCCAG
AGATGGAAGCGGCAGCTTTGACAGCTACAGGGGGTCTTCCCAGAGAAACAGCAGCTCTGACATCACAAAGAAGTACAAGT
TGCCTGCAGACCCGTGGCACATCCAAGTCCGCTGGGAAACTGAAGGTATTTCCCATACCGAAATAACGACCAGGCAATGA
AGGGCATGGCTAACTCTTTTCACAGGTATTCGCCGATCAGCAATAGGAACGAATGTGGCCACCCCCGAAGAAGTGGAGGC
AGATAAGCTCCTGGTGCGAAAGACCGAAGACGACAGCAAGATCCAGGTGGTGGCTATGCGGCTGGATATCCAAATCTACG
AGATGGAGCCATCTGTCTATTTGGTCGACTTCAAGTGCAACGGCTACGAAACAGCGGAAGGTCACATTCTGGAGGAGAAA
GAAGTGACAAGCGCTTTCCCGTTCCTCGATCTTGTCGCTAAGCTCATTCTCATGCTGGCCGATGGCGAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62