GenePrediction:GLEAN_3337 Details

Name: GLEAN_3337
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:725067..726745 (+ strand)
Length: 1679
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:725067..725405 (+ strand)
Length: 339
Type: CDS
Source: GLEAN
Position: GCSC_89:725468..725526 (+ strand)
Length: 59
Type: CDS
Source: GLEAN
Position: GCSC_89:725595..725659 (+ strand)
Length: 65
Type: CDS
Source: GLEAN
Position: GCSC_89:725723..725749 (+ strand)
Length: 27
Type: CDS
Source: GLEAN
Position: GCSC_89:726177..726745 (+ strand)
Length: 569
>GLEAN_3337 class=GenePrediction position=GCSC_89:725067..726745 (+ strand)
ATGACTACTGCCGACGTTATTGCCAAGATAGCGGCCGCTGAGATGGTTCTCGACAACGGGACCACAGCGTCGGCTGCCCG
GGATCTGCGCGCCCAGACACGCACGCCCGAGCTCCAGACGAATCCGCCCAGCCAGAGCGACGGCAACGGGAACCGCAATG
GCCGCGGCCGACCGATTGGCCAGAAGGCCTCGATCCTGGACGCCCAGCATCCTCCCGGCACCCCGGGCCACATCCCGCCG
TTTGACTGGGACGAGTTTGAGGCTCGCTACGAGCAGGCCCTGGTCGAGATGAACGGCGAAGAAAAGGAGCTGCTGGAGGA
TTTCGACCAGCTCGTAAACGTGCGCATGGCCCACACAAACCCCTTCTCTTGCTAGTGACCGGGCTGCTGACCTGTCCGCA
GTACTTTAACGTGTGGGCGACTGCCGCGTCTGCCCACGACGACGAGCGGGCCGTAAAGCGGTATGCAGCAGTCTTCTGTC
TCTTATATTCTCTCGTATCAATTCTAACACTACTCTCTGCTTTACCAGTCTACAGACGAGGGAGCGATACGTCAAGATTG
CCGAACAGAGCCTTGGTCAGAGAAAGCAACACCGTGAGTCCTCTGATGTCCGCTCACATAGCCACATTATTTGTCTCACC
GTCTAATCACATACAGTCACCGAAGTGGTCCGCGCCTTTCAGAGTGCGCTGGCTTTGCTAAGCCAAACATAGAGCCTTTT
GACAAGGTCCCAGGTTACATGGTGTCTATGGCGTTTCCCTTCAGCAAGCCTTCCTCATCTTTTTCCGGCATACCGCTGTA
TTTCAGAACCTCCATAGTGCTCTCTTTATGTAACACGATGTTATCAACTCTGCCGGACATGAATAACATTCAATGCTTTT
CGCCGTGAGATAAAGGTCAGGCCAGCTAGATGTCTCACGTGATCGAGCGGATCCCTACTTAAGCTCCAGCAAGGCAGGTC
TGCTCCAATAGTCTCCTTAATCCTCATTTAAATCGAAATGGCAACATACTTGAAGTTCAATGTGCCGCAAATAACACAGG
TCAGCTTTTTCTCTCCGAATGATCATATACTCCGTAGGTGCACATTCTAACACATAATTGAAACAGGCAGATCTGTTTGC
CTTTCACGAGGCTCACTTCTCCGGGCATGCAACGAATGACTTCAAGACCACATTTCTAGATGGAGAGCGTCACGGTACAC
GCGACCATTCCCACCCCCTTCTCGACACATTCGATGAGCTTGTCGACGGGGAGGGCGGAGATAACGATGAGAGTGGCTGG
ACGACCCAAGACCTCACGCCTCTCAATTTGATATCTGGCCAGGAAGGAGCTTCAGAGATTCAGTGCTACAATCTATATGC
TGCTGATGGCGAGGTTTCGGAGTCCTTTCGAGAAACTCTTAGCGACGACGTACCCTTGATGGACGGCGACAGTACTAGCG
AAGCCCTCGGCGATGCCGCAGGGGGACTCAAAATGACTACCTCCCAGAAGAAAAGGAGGAGGCGTAAGAACAACAGCAAC
AACACAAAGCGATACCAGGAGAAGCCTGACTTGCGGAAGCGAACATGGGATGTTGTGGACAGCGGTCTCGGCAGCCTGGA
TTACGATGATATGGAGCAGCGCCAGGCTTCGTGTCTAGTGCCACCACAACGCCGGCAAGTTACATATGACGATGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62