GenePrediction:GLEAN_3338 Details

Name: GLEAN_3338
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:727569..729017 (+ strand)
Length: 1449
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:727569..727641 (+ strand)
Length: 73
Type: CDS
Source: GLEAN
Position: GCSC_89:727728..727769 (+ strand)
Length: 42
Type: CDS
Source: GLEAN
Position: GCSC_89:727894..728072 (+ strand)
Length: 179
Type: CDS
Source: GLEAN
Position: GCSC_89:728140..728334 (+ strand)
Length: 195
Type: CDS
Source: GLEAN
Position: GCSC_89:728396..728821 (+ strand)
Length: 426
Type: CDS
Source: GLEAN
Position: GCSC_89:728904..729017 (+ strand)
Length: 114
>GLEAN_3338 class=GenePrediction position=GCSC_89:727569..729017 (+ strand)
ATGGCGCGTGTATATGCGGATGTCAATCAGAACATGCCACGTTCCTACTGGGACTATGACAGTGTCAATATCAGTGAGCG
CTGCCTTGGATGAGCGGTGGCGTATTTTCTTTGCGGCTTCCAAAGGCGCATCAATCTGACCATCTGTCTTTTCTAATAGG
CTGGGGCGTTCTGGAGAACTACGAGGTCGTCAGGAAGATCGGTACGTCGTCGAGGGAGAGAACACGAAGAGCCATATCAA
CCAAGCTCCGGCTTTGCGCGCAAGTTGCGCTGGGATAACATAACAAGACGGAACGAGCTAACATTGTCTCCCTGTGCCCC
ATTAGGCCGTGGAAAGTACTCTGAAGTATTTGAGGGCATCAACGTCGTCAACTACCAGAAGTGCGTCATCAAGGTGCTGA
AGCCTGTTAAGAAGAAGAAGATCAAGCGCGAGATCAAGATCCTGCAAAACTTGTCTGGGGGTCCCAACATTGTCGCGCTG
CTGGACGTTGTGCGCGACTCGCAGGTACGACACGATTTTTGATCTCCATATCGTGTAGCTGTCCAGAAATAAGCCTAACC
CCTTGCCATAGAGCAAGACACCGTCGCTCGTCTTTGAGTGCGTCAACAATACGGATTTTCGGTCGCTCTATCCCAAGTTT
ACCGATATTGATGTGCGCTTCTACATTTTGGAGCTGCTAAAGGCGCTGGACTTTTGCCACAGCAAGGGCATCATGCATCG
CGACGTGAAGCCACACAACGTCATGATCGACCACGAGAACAGAAAGGTGAGCTCCCGGTCGCTGTTCTCGTATCTCCATC
TCCATTGTTCCCTCTCTTTCTGACGAGAACAAGCTGCGCCTAATCGACTGGGGCCTGGCCGAGTTTTACCACCAAGGCAC
CGAATACAATGTGCGTGTCGCGTCGCGTTATTTCAAGGGACCCGAGCTGCTGGTCGACTTTCAGGAGTATGACTACAGCC
TCGACATGTGGAGCCTGGGCGCCATGTTCGCGTCCATGATCTTCCGCAAGGAGCCCTTCTTTCACGGAAATTCCAACTCG
GACCAGCTCGTCAAGATCGCCAAGGTACTCGGCACCGACGATCTGTTTGACTACCTGGACAAGTACGAGATTGAGCTTGA
CGCGCAATACGACGACATCCTCGGCCGCTTCCAGAAGAAGCCTTGGCACAGCTTTGTCAACGTGGAGAACCAGCGATTTG
TCAGCAATGATGCAATCGACTTTCTTGACAAGCTGCTGCGTTACGACCATGCTGTACGTGTTTGTTTGTTTGTTTTTTTC
GCATATCCACGTACAGTCCTGTTCCAACCCTCGTTCTAACCTCTCGCTTTTATAGGAGCGGCTGACTGCTCAAGAAGCAA
TGGTACACCCCTACTTTGATCCAGTCCGGGAAGAGGGTACGAGGCAACGGTTGCTTCTGAACCCGCCCACGATTGCAGCG
CAGTCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62