GenePrediction:GLEAN_333 Details

Name: GLEAN_333
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1128981..1130483 (+ strand)
Length: 1503
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1128981..1129164 (+ strand)
Length: 184
Type: CDS
Source: GLEAN
Position: GCSC_167:1129241..1129269 (+ strand)
Length: 29
Type: CDS
Source: GLEAN
Position: GCSC_167:1129350..1130483 (+ strand)
Length: 1134
>GLEAN_333 class=GenePrediction position=GCSC_167:1128981..1130483 (+ strand)
ATGGTTTCTCCGTCGGTCCGGACGTGGGCACCGCTGCTGCGGACGGCCCGCGTGGCCCTCCGGACGCCGGCTCGCGGTAG
CCCGTTGGTGACGATGCAGCGTCAAACCGGCACCGCGTCACCGATCCTCAGCTTCTGCCGGACATACGCCGTGTACGAGC
GGTCAAAGCCGCATGTCAACATTGGTACGTTGGCATCAATTGGGTGCAGCGGAGGCATCCGGAAGACTTGCCGAACATCC
CACTAATATCTGACTTTTAGGCACAATCGGCCACGTCGATCACGGCAAGGTGTGTTTAAGCCCTGAGCATCGATCTTCTG
CTGTGTCCTTCTGTCTTTCTTTGAATTCGCGACATTAACCTGGGACCAGACCACGCTGTCTGCCGCGATCACGAAGCGCC
AGGCCGAGAAGGGCATGGCCAACTTCCTTGACTACGGCTCCATCGACAAGGCTCCCGAGGAGCGCAAGCGTGGTATCACC
ATCTCCACGGCACACATTGAGTACGCGACCGAGAACCGGCACTACTCTCACGTCGACTGCCCCGGTCACGCCGACTACAT
CAAGAACATGATCACGGGCGCTGCGAACATGGACGGCGCCATCATTGTGGTGGCCGCATCGGACGGCCAGATGCCGCAGA
CCCGCGAGCACCTGCTGCTGGCTCGCCAGGTCGGCGTGCAGAAGATTGTGGTGTTCGTCAACAAGGTGGACGTGATCGAT
GACCCGGAGATGCTGGAGCTCGTGGAGATGGAGATGCGCGAGCTGCTGACGACATACGGCTTCGAGGGTGACGACACGCC
CGTCATCATGGGCTCGGCTCTGTGCGCGCTGGAGAACAAGCGGCCGGACATTGGCAAGAAGAAGATCGACGAGCTGCTGG
CTGCCGTTGACAGCTGGATCCCTACACCGCAGCGCGACCTGGACAAGCCGTTCCTGATGTCGGTCGAGGACGTCTTCTCG
ATCGCCGGCCGCGGCACCGTGGCCTCGGGCCGTGTCGAGCGCGGTACGCTCAAGAAGGACACCGACGTCGAGATTGTGGG
CAAGGGTCTTGAGGTGATCAAGACCAAGATCACCGACATCGGGACGTTCAAGAAGTCGTGCGACGAGGCGCGCGCCGGCG
ACAACTCAGGCCTTCTGCTGCGTGGTGTCCGCCGCGAAGACGTGCGTCGCGGCATGGTCATCTGCAAGCCCGGCAGCGTG
TCGCCGCACTCGCAGTTCCTCGTGTCGCTGTACGTGCTGACCAAGGAGGAGGGTGGTCGCCACACCGGCTTCCACCAGAA
CTACCGCCCGCAGATGTACCTGCGGACGGCCGACGAGTCCTGCACCCTGACCTTCCCTGAGGGCACCGAGGACGCCGACT
CCAAGATGGTGATGCCCGGTGACAACGTCGAGATGCTCGTCACGCTGCACTCGCCGCTAGCTGTGGACAACGGTCAGCGT
GTCAATGTGCGCGAGGGTGGCCGGACTGTCGCTACGGGTATCGTAACGCGGATCCTAAAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62