GenePrediction:GLEAN_3340 Details

Name: GLEAN_3340
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:738014..743314 (+ strand)
Length: 5301
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:738014..738290 (+ strand)
Length: 277
Type: CDS
Source: GLEAN
Position: GCSC_89:738348..742869 (+ strand)
Length: 4522
Type: CDS
Source: GLEAN
Position: GCSC_89:742924..743314 (+ strand)
Length: 391
>GLEAN_3340 class=GenePrediction position=GCSC_89:738014..743314 (+ strand)
ATGTACAGACAACACCCGTTGAGACAGTCCCAAACAATCGACTACCCGGTCACTCGACAGCCGTCGACGGCGTCTTCGTC
CGCGTCGTCGGGCTACTCGACCACCTCGAACCAAAGCTCCATCGCCAGCAGCATGACCTCCCATGCCAGCGCATACTCAA
CGCCGAGCCATAAACGCGGTCAAAGCGAGGCTAGTAAACTGACGCTGACGTCTTCCTTCTCCGGCCTCAATATCACATCA
TCCCCACCCAAGGCGGACCCAGACAACATCTACAACAGTGCGCGGCGTTCCTTGAGGCCGCTGCCTCAGCCCCCAGCTAC
TAGTTCACCGCCAGTGTCGCCCACAAAGTCTCCAGTGTCGCTCATAAGTACTCCAGGGGCGTCCGCAAAGACCCCAGTGT
CGCCCACAAAGAGCCTTATCCGACATGAACGTGGTCTGAGCGTCGACACGGGCAAGTTGGCAAAGTCTTACGAGAATGAT
CGCTTTGCCGTCGCCGGATCGCCGCAACCTCGCCCCTCACCTCTTCGACCCAGTTCTATGTTCCTTTCCCGATCGGACGC
TGTTAACCACGGAGGCAGTGCCGCTGTAGCTCATGCTAATGCTCCCCTGGCTCTACACCACGGCCATTCGGCAATAATAC
AGGCACCCGATTTCAAAACGCTGGGCAAGTCCTCTACAAATCAGCTGCGCACACTGTCGAAACTCGCCCAGTCCGGCTCG
GCCGACGAGTTTGCGCTTACCGCCCCGACACAGGAGGTGGTCGGCTTGCGCGGTCGCAGACGTCTACAGAGAGCCGACGA
TGCGGCACCAAACAGGCTGGGTCACCGAGGCGGCGCCTATGGCTGGGAGGGCAGGAATTGGATGGATAAGCAGCGGCAGT
TCCTCCAAGCCTATGAATACCTTTGTCATATTGGAGAGGCCAAAGAATGGATCGAGGATATCATCCGACGTGCCATTCCT
CCTATCGTCGAGCTTGAGGAAGCGCTGCGGGACGGCGTCACACTCGCAGAGGTCGTGGAAGCCTTGAATATCGAGAGACG
CTACAAGATTTTCCGACATCAGAAGCTACAGTACCGCCATTCTGACAACATTGCCATTTTCTTTCGCTATCTCGACGAGA
TTGAGCTTCCCGACTTGTTCCGCTTCGAGTTGATTGATCTGTACGAGAAAAAGAACATACCAAAGGTTATCTACTGCATC
CATGCCTTAAGTTGGCTCCTCTTTCGCAAAGGGATTGTCGATTTCCGCATTGGAAACCTGGTTGGACAACTCGAATTCGA
ACACCATGAACTCGAAGCAATGCAAAGAGGCTTGGACAAGCTGGGAGCTAACATGCCGAGTTTTGGAAGCATTGGTGCCG
ATTTTGCAGAGGAGCCCCCAGAACCCCCCGAGCCAGTCGAGACAGAAGAAGAAAGAATCGATCGTGAGCTCGGCGAAAAT
GAGGCGGTCATTTCAGACCTTCAAGCCCAGGCCCGTGGCGCATTGCTACGAATGCAGCTCGGGCAGACAATGCAGCAGCT
CTGGGATTCCGAAGACTGGCTAGTCGATCTTCAATCCCGTATTCGCGGCGATTTTTCAAGACAGATATCCGACTACCGTC
TGCAGATGAGGAGTTTTGCAACCAACTTGCAGAGTGCTGCACGCGGCTTTCTTACACGCCAACGGCAACAGCAGGAGGAG
AATGCCTGGAAAACCACAGAAGGCGACATTCTCGAGCTGCAGAGCCTGATACGCGCCGGCAAGGTCCGCAATGAGATTCG
AGACACTCAATATCAGCTGGAAAAAGCATCGGGGCCACTGCGCGAGATCCAAGCCGTTTTCAAGGGCTTTCTGACGCGGC
AGAAGGTGCAAGATGCCGACTCCCAGCTGAAACTAGCATCAGGGCCAGTGCGCGATATACAAGCTGTTTTCAAGGGCTAC
TTGGCACGCCAGAAGGTGCGGGACACTCAATCTCAGCTGGAAACAGCATCCGCACCTGTGCGTGCAGTCCAGGCCGTGTT
CAAGGGCTATCTGGCACGACAAAAAATACAGGCTCAGCAGCAAGATGTGGAGGATGCAACGGCTCCGACATCTGCGCTGC
AAGCGTCTATTCGGGGTATGCTGTTGAGGAGGCACCTGGCTGAAGAGCAGAAGGCGCTCATGGCCGAGAGCGGTCCTGTC
TCGGGATTTCAGGCTGCCGCGAGGGCAATGTTAGTCAGACGCGAGATCGACGAGCAAAAAAGCGCCCTTGAGGGCTTTGC
GCCCCAGTGGGAAGAGCTCCAGGCCCTTGCTAGGGGCAAGGCTGTTCGCGACGATGCTCACGCATTGAGAGCAGAGCTTG
GTGAGCACACTCCACTGGTGGAAACCCTTCAAGCTTGCATTCGCGCGGCTGCCGTCAGGCGCGATGTTGCCGAGACGCTC
GATGCGCTGCAGGTCTGCGAACCCGAGATCATCGACCTGCAGTCGCGGATTTGCGGGATGCTACAGCGTCGACAGGTGGC
TGCCGATCTAGAGGCTCTCGACGCGCAGGTTCCAGAGATCATCAGCCTGCAATCTCATGTCAGAGCATTCCTATTCCGTC
AAGAGCAGGCTGCCTTTCTCGAGGAGCTCCATACGCATGAGCCGGAGATCGTTTCCCTCCAAGCGTTGGCACGGGCTATG
ATGCTGCGAAGCGAGGTTGCTCAGCTGTTGGCAGAGCTGGACGAGCACGAAGAGTCCGTGGTAGAGCTGCAGGCTGTTGC
CCGAGCATACCTGGTTAGAATCCAGTTTGCCGAGAAGCAGCGCTTCTTCAACGAGAACATGCAGAAGGTGGTCAAGATTC
AGAGCTTTGTCCGTGCAAAGCTTCAGGGCGAAGCCTACAAGAGCCTGACGACGGGTAAGAGCCCGCCGGTTGGCGCGGTG
AAGAACTTTGTGCATCTGCTCAACGACAGCGACTTTGACTTCAATGAGGAGATCGAGTTTGAGCGCCTGCGCAAGACGGT
GGTGCAGCAAGTGCGCCAGAACGAAATGCTGGAGCAGTACATTGATCAGCTCGACATCAAGATCGCCCTCCTCGTAAAGA
ACAAAATCACGCTAGACGAAGTCGTCCGCCACCAAAGCAACTTTGGCGGCCACGCCGGAACATTTATTGCCAACAGCTCG
ATGTCGTCGACCAACCAGTTTGATCTCAAGGCCCTCAACAAGAGCTCTCGCAACAAACTCGAATCCTATCAGCAGCTGTT
CTTCAACCTGCAGACACAGCCACAGTACTTGGCCCGGCTTTTCCGTCGCATACGCCTGCAGGGAATGCAGGAGAAGGAGT
GCAAGCGGGTTGAGCTTCTGATCATGAGCCTCTTCGGGTACGCGCAAAAGCGGAGAGAGGAGTACTACCTGCTCAAGTTG
ATTGCGCGGTCAATCAGTGAGGAAGTAGAAAGCGCGGCTACCGTCCAGGAGTATCTCCGTGGAAACTTCTTCTGGCAAAA
GCTGCTGTCGAACTACACCCGATCGCCGCGTGATCGCCGGTATCTGCGTGACCTTTTGGGGCCCATTATCCGGGACAACA
TTATCGAAGATCCGGCGCTCGACCTGGAGAGTGATCCAATGCAGATCTACCGCTCCGCCATCAACAACGAGGAACTCCGG
ACTGGGCAGCCGAGTCTCCGTCCGCGTGAAGTGCCTCGCGAGGTCGCCATCAAGGACCCCGAGACACGCGACCTGTTTAT
CGACCATCTCCGTGACCTGCGGGAAATCTGCAATCAGTCCCTACTGGCGATCGAGGATTTGCTGCCGCGCCTTCCATACG
GCATCCGCTTTGTCTGCCAGCAGATGCTCAACTCCTTCTGCCAGCACTTCAAGCACGAAAGTCCGCAATTCCTCCTTCAG
CTTGTTGGGAGCTGGTTCTGGCGTTTCTATCTCCAGCCAGCGGTGACAGCTCCCGAAAATGTCGGCGTGGTCGACAAGCA
GCTGAGTCCGCTGCAGAAGCGGAATCTTGCAGAGGTGGCCAAGGTACTGGGTCAGATCGTGTCCGGACGGCCGTTTGGTG
GCGAAAACATTCACCTGCAGCCTCTCAACGGGTTTATCGCAGACTCGATCGGCAGGCTGGGCCGCATCACCCAGGCGGTT
GTTTCGGTGCCGGACGCTGAGCACACATTCGACATTGACGAGTTCAACGACCTGTACGCGAAGAACCGGCCGACTCTGTA
CATCAAGATGACGGACATCTTTGCCGTGCACCAGCTTGTGACTACGGAGCTGCCCTCGATGTGCCCGACCAGAGACGATA
TGCTGCGCGAAATCATGCATGAACTTGGTAGCGCCAAGAACAACGAGAGCGAGATGATGGCGGCCGGCTCATCCGATATC
CAGATGATCCTCACGCCAAAGCTGCACGATATCGAAGACCCCGAGGCCGAAGTGAAGGCGTTGTTTATGGAGACCAAGCG
CTGCATTCTATATATCATCCGAGTGCAGACGGGCGCAAACCTCCTCGAAATCCTGGTGAAGCCAATCGTGCCGGCCGACG
AAGTCAAATGGCAGGCACTTCTACATGAAGACTTTGCCGTCGGCACAAACACCCGAGGCGCGTACTCTGATGCAAACATG
GTGGATGTTACTCGCATGACCTACCACGACATGAAGCGCACGGCCTTGGAGAATGTTCTGCGCCTGGAGCAATGGGGACG
TATCTCCAAGCAAAACCAGTACCAGGACGTTCTTAACGCGATTGCCCTGGACATCCGGACGAAGAGCCGTCGGCGTGTGC
AGCGGCAGCGCGAGCTGGAAGGCGTGCGGCTGACTCTCAGTAATTTGCACGAAAAGGCCACGTATCTGGAGCAGCAGCGC
AAGAGCTACGACGACTACATCGAGCAGGCCATGGCGACTCTGCAGAGCAAGAAGGGGTAAGTCGTTCCATGCTGTCTCTG
ACATGTTAATACCATCCTAACCACAAACAGGAAAAAACGGTTCCTCATGCCGTTCACCAAACAATACAACCATCAGCGAG
AGCTGGAGCGCAGCGGACGCGTGCCAAAGTTCGGTTCGTACAAGTACAGCGTTCGGGCACTATCAGACAAGGGTGTTGTC
GTCAGCTGGGTTGGGGTTATGGACCGCGACTTTGACCGGATCAACCTGACGATATCGTGCGACGAGGTCGGTGTCTTCTC
CATCGAAGCTTCCCGAGGACACGTGCAAATTCCCGGGGCCAGTGCTCTGGTGTCGATTGAGGACCTCCTGCAGGCGCAAT
TCGAGTCGCATCAGTTTATGAACCTCTTTGAGAATAGGCTGCGTCTCAACGTCAACCTGCTGCTGCATCTGGTCTACAAG
AAGTTCTACCGAACACAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62