GenePrediction:GLEAN_3343 Details

Name: GLEAN_3343
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:764258..765415 (+ strand)
Length: 1158
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:764258..764311 (+ strand)
Length: 54
Type: CDS
Source: GLEAN
Position: GCSC_89:764627..765415 (+ strand)
Length: 789
>GLEAN_3343 class=GenePrediction position=GCSC_89:764258..765415 (+ strand)
ATGTTTGCGCGCACCGCATTCCGTACGCTTCAGTCGGCAGCGCCGCTGAGACAGGTAAGCCGAAGCCGTGAGCTGCGGCA
GTAGGTGAAAGGAGCTGTCTATTTTGTGCAGACCAATGCCGCAGTACAAATCGGAGGCCGAAGCTGACACACTGCGCAGC
TGACATCCTGCCGCCGGTATGCGACTGGTCCTTCTCCGAGCAGCGGCAGCGGCAGCAGCACACTGCTGATTGCGGCAGTC
ACTGCGGCGGCAGCGGGCGGCGGCGGCTACTACTTTTACTCCACGAGCGCGGCTCCGGCAGAGAAGGTGACGGCGACAGC
GAAAGAGACGGCAGCGGGTGCAGCATCCGAGGTGACGGGCGCGCACAAGGAAACATTCACGGGCGGCAGCCAGGGATTCC
TGAGCCTGGAGCTGGAGAGCGTCGAGACGCTCAACCACAACACGAAGCAGTTCCGGTTCAAGCTGCCGGAGGAGGACAGC
GTGTCGGGGATGCACGCAGCATCGGCGCTGCTGACCAAATTCAAGCCAGAGGGTGCAGAGAAGCCGGTGGTACGGCCGTA
TACTGCGGTCAGTGACGACGACGCGGTCGGCCACCTGGATCTGCTCGTCAAGAAGTACGAGGGCGGGCCGATGTCGACGC
ACATCCACTCGCTGGTGCCGGGCCAGAAGCTGGAGATCAAGGGTCCCATCACCAAGTACCCATGGGCACCCAACAAGCAC
GAGCACATTGCTCTGCTGGCGGGCGGTACCGGCATCACGCCCATGTACCAGCTGCTGCAGGCCATCTTCAAGAACCCGGG
CGTCGATAAGACCAAGGTGACGCTGGTGTTTGGCAACATCGCCGAGGAGGACATTTTGCTGCGCAAGCAGCTGAACGAGC
TCGAGAACACGTACCCGCAGCAGTTCCGCGTCTTTTACGTCCTGGAGAAGCCGCCCTCCGACAAGTGGACCGGTGGCTCC
AAGGGCTACATCACCAAGGACCTGCTGAAGGAGGTGCTGCCCGAGCCGACGTCGGGCGATATCAAGCTGTTTGTCTGCGG
ACCCCCGGGTCTGATGAAGGCTGTGTCCGGCCCCAAGAAGAGCCCGAGCAACCAGGGCGAGCTGACGGGCGCCCTCAAGG
AGCTCGGTTACACGGCCGAACAGGTCGTCAAGCTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62