GenePrediction:GLEAN_3345 Details

Name: GLEAN_3345
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:776990..779774 (+ strand)
Length: 2785
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:776990..777109 (+ strand)
Length: 120
Type: CDS
Source: GLEAN
Position: GCSC_89:777210..777312 (+ strand)
Length: 103
Type: CDS
Source: GLEAN
Position: GCSC_89:777414..778842 (+ strand)
Length: 1429
Type: CDS
Source: GLEAN
Position: GCSC_89:778904..779066 (+ strand)
Length: 163
Type: CDS
Source: GLEAN
Position: GCSC_89:779223..779774 (+ strand)
Length: 552
>GLEAN_3345 class=GenePrediction position=GCSC_89:776990..779774 (+ strand)
ATGAAGAGCACGCCTCTGATCATCAATTGGCATGACCAGAATGCCCCGATCTATTCGGCCCACTTTGAGCCGCACGGCAA
GAATCGTCTGGCCACGGCTGGGGGCGACAACAATGTTCGGGTAGGTGGACGTGTCGGCAGCGCCAGCAGCGACTGGCAGC
TCCGGCGTCCGTTCGTTTGGGTTCAGAACGGGCAACTGACCGGGTCGGTCCCATGTGTAGCTCTGGAAGGTCGAGTCCAA
CGGCGAGAACAGAAAGGTCGAGTACCTGTCGACGCTGGCAAAACATACGCAAGCCGTGAACGTGGTTCGCTGGAGTCCAA
AAGGTGTGTCTGCTCATCGCTTCCCTTCCTTTCTTCTCCTTTCTTCTTCTCTTCCCTTTCTCTCCCTTCTTCTCCCTCCT
CGTATCCCCCTGCTAACACCTCAGGCGAGCTCCTGGCTTCTGGTGGCGATGACGGCAACGTCATCCTCTGGGTGCCGTCG
GAAAGCTACCACCCGACCTTTGGCAACGACGGGTACGAGGACAGGGAGACGTGGCGGACAAAACACATGTGTCGGTCGTC
GGGGGCCGAGATCTACGACCTGGCCTGGTCGCCAGATGGGTCGCACTTTATCATCGGCAGCATGGACAACATTGCTCGCA
TATACAATGCTGCCAGCGGCGTGCTCGTCCGCCAGATCGCCGAGCACAGCCATTACGTGCAGGGCGTGGCCTGGGACCCG
CTCAACGAGTACATTGCCACACAGTCGTCGGACCGATCGGTCCATGTCTACTCGCTCAAGGCCAAGGACGGCCAGTACAT
CCTGACGGCCGGCCTCGACGACAAGGCCCCCAAGTTGGCCAGCCACATTAAAGCTGACCTGCCGCCACGTCGTCTCGCGT
CGCAGAGCCCGGTGCCGCCGGAGCCGATCCTGCCGTCGTCGTCCAACGGCCACCGGACCCAGTTGTCGGTCATGGATGCT
GTACCACCCATGGGCTCGCCAGTCCCGTCCGCTCCCGGCACCCCTACGTCTGTGGCCCTGCCGATGAACCCTCCCAGTGT
CGTCAGCCACAGCCGACGCTCGTCCTTCTCTTCACGGCGGTCCGTCTCGCCGGCACCCTCGACCATGCCGCTGCCGGCTG
TCATGCCCATGGAGGCGTCGCCGAAGCTGCACATGTCCAGCTCCAACATCGGCCTTGGCTCGTCGGCTGTCGGCATGAAG
AACGCCAATCTTTACGCCAACGAAACCCTGACCTCCTTCTTCCGCCGCCTCACCTTCACGCCCGACGGCAGCCTACTGTT
GACACCCGCCGGCCAGTACCAGACCCAGCACCACCACGAGGGCTCGAAGCCGTCGTACGAGATCATCAACACCGTCTACA
TCTACTCGCGCGGCGGCATCAGCAAGGCTCCCATTGCCCATCTACCCGGTCACAAGAAGCCGTCGGTGGCGGTGCGCTGC
TCGCCCATCATCTACACCCTGCGTCCGTCGGCCGCGTCGACAAAGCACATCACCATCGACACATCCTCGGCCGAAGAGCC
CATCATCCCTTCGCTTCCCGACCCCATCTCCAATCCGACCTCGGTGCCGACCTCGACAGCCTCCGTCATGGATCCGCCAC
CACCGCCACCACCGCCGCCACAGTCTCACGCATCCGCCGCAGATCCTGCCACCCCAAACGCCAAGATACTCGGCAGTGCT
GAGACGGTCGCCACAGCGGCGACGCCCGGTCCCAAGTCTGCCTTTGCCCTGTCCCATCGCATGATTTATGCCGTGGCCAC
ACAGGATTCCATCTTGCTGTATGACACCCAGCAGCAGACGCCTCTCTGTGTCGTTAGCAATCTGCACTGTGCCACGTTTA
CAGATATAACATGGTAAGTTTGGAAGCCGCTTTCCTGGATGAGCTTGTCTTTCAACCCATGCTGACCCGAACAGGTCGAG
TGACGGCCTGACACTGCTCGTCTCCTCATCAGACGGCTTCTGCTCCACACTCTCCTTTACGCCTGGCGAGCTGGGCCAGC
AGCACATGGGCGAGACAGCACTGGTCCGAGAGTGGAGCCGGCAGGCTGCAACCGGCGCGTTTGGCGATATGACCGTGGTA
GGCACACCTGCTTCGGCTGCAGCGACGGCGGCGGCAAATGCGGCAACTGTGGCGGCTGCAGCTGCGACGTCGTCCGCTCA
AAATACGCCCATTCCCACGCTCACGTCGATATATGTGCCTACGTCTCCCTTTCCTAGTGGCAGTGGCCACCAGCATCGCA
ACTCGGCCAGCTCGTTCACGGCACCATCGCCGCCGGCCACGGCGTCCTTTGCTAGCTTTGGAGGGAGCAGCAACAGCAGC
GCGAATGGCGGAAACAGCAACACTGCCGCTTCCACCGTAACGATGCGTCCCTCATCGCCGGCCCGGTCGAACTCGGCGTC
GTCCGTGCTGACACAAGCATCGCTGGCCGCCCTGAACAACCCGCCGCTGGTGGTGGGAAGCATGCCGAGCCTGGCTGCCA
CGGCTGCTGGTGGTACTGGCAAGACAAGCTCAGCTCTCGCGGCTGCAGTTGCCGCAGCCGCCACGCCACCCGAAACGCCA
CGCAACCGTGCTAGCAGCGTCACAAGCAGCGTGGCCGGGAGCGTGACTGCTGCAGCCACAGCATCGTCGCTGTCAGTGCC
GGTGACGACGGGCACGAAGCGGGAGGCCGGCGCCGAGGGCGAGAAAGAGGACGTGTCAGTAGTGACGGGAGAGCCGGAGC
CGAAGAAGCGGCGAATCGCGCCGACGCCTGTAATCAGCGGTAGTGACGGCGGAAGCAGTGCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62