GenePrediction:GLEAN_3346 Details

Name: GLEAN_3346
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:786410..788366 (+ strand)
Length: 1957
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:786410..786464 (+ strand)
Length: 55
Type: CDS
Source: GLEAN
Position: GCSC_89:786523..787173 (+ strand)
Length: 651
Type: CDS
Source: GLEAN
Position: GCSC_89:787237..788366 (+ strand)
Length: 1130
>GLEAN_3346 class=GenePrediction position=GCSC_89:786410..788366 (+ strand)
ATGGCTCCCAGCTTAGAAAGTCTCCCAGTGGAGATCTTCCTCCAGGTCATCTCGTGTGAGTGCTTCCCAGAGTCCCGCCT
GATGCGCACGCATAGCTCTGACAAGTAGTTCAGATCTGGAAGTATTGGATATAGTGAGGCTGCAGCTTGTGTCCAAGCAA
CTGCTCCGTACTGGCCGGGATGATGGCTTCTGGCGACTGCGAAGCTTCGACGACAGCACGTATCTCGAGACACTCATGCG
GCGTCGCATGTTGTTTGGGCAGCGCAGCGTCGGTGTCGACGAGCAAAGAGCCCCTGCATCGCCAACGTCCGTGGAACAAG
AACGCTCTCGCGAGAGGTTCCGTATCATGGCTAACTGGGACCCGGTCTATCCGGGCGAGAAAGTTTCGTGGTACGACGAA
TACATCCAGCGGAACGCGCCCATCGTGATGAACTGGTTCCAGCTGCCGCGGCACAGCGACAGCAGCTCTTCCAAGGAAGT
GGCCGTGGAGGCTCGTGGCGTTGCGCTGTATCGACCAGACGGTGCCGATGGCAGCCTGCTGGCTGTCTCGCCTCTCGACG
ACGGGTCTGTTTGTCTCTGGGACGTCAAGGGGACCAGGGGCCAGGCCGGTGCCATCGTTGCCCAGAGTGCTCCCGGCATC
CTCTTCGGTGGGCTGCTTTCCGACCTAGGCAGGGCGACGAGGAGGCAGAGGCCTCAATTCACCACAACTGAATGCGTCAG
CGTCGACAGCCAGCGACATCTGGCCTTTCTCTCTGTCCAGAACCGTTGGTTGACTCCGTGCATGTCCATGCATACCGTGC
ACAACGGCGGCTAACTCTAGGTGGCAGGTCTGGTCGAAGTGGATCTACAGAGGCTCGTCGCAACAGGCGAAGAGACGTTT
CCCTGGGCCATCACTGCTCTATCCACATCGCACCCTACCGTGCCTCTGTCAATCGGCATGCACCTAGGAGTGCACATGCA
CGATACAAGAGTGAGAGCAGGAAATGGGACGTCAAAGCACACTAGCCGAAACTACGGTGGCGATGACGACGACGACGACC
GTTGCCAGCCCCGATGTGCCCCAGCACCCCATCCGGAACCAGGGCCGATATCGATTCTCCACCTCCAGCGCCCTGGGTCA
GAGGAGGACATGTCCGACGACATCTACACTGCCGGGCGGCTGCCCATCATCCTCCACTACGACCGGCGGAAACTCTCGTC
CATCAAGGGCACGATTTATTCGGGGGCCAGCCTATGCAGCATGACGTCCTTTCCGTATCCCTTTTCCGCACTGGACTCGG
ATCTCCGACACGAAGGGGTCCTATCTCTGGGCCAGGTCGAGAGGGCCAAGGCCGTGCCGGGCGGACGTACGATAGTGGCA
TGCGGCGAGTACAAGTCCAAGGGCTCGCTGGAGATGTATGGCATCGGCATGGTGCCCGAGGCCGCCACAACCAAACGGCC
AGAAGGGGTGCAGTACCGCGAGAACTCGACACTGAAGAACCGGCAGACGTCGTCGTTCTCCAAAATTCTGGCCGTGACCA
CTCACGGCACGCGGCTGGCCTTTGCAGACGGGGCAGGGCAGATCAAGTGGTTTGAGCGGGACGGTGTTACTGAAGTGCGG
AGTTGCGCCATCGATGGGGGAGAGAGCAAAGAAATGGCGCCGTCTCTGTTTGGCCCAGCAGCACAGGACTCGGGCGACAT
TGCAAGGAAGCTGCTGCCCACCCAACAAGCCGGCGGCTCCGGGGACAACGAGCTGCTGTTCTGGACGGGAGAGCGTCTCG
GACTCGTCAGCTTCTCGTCCAAGCCCGGCTTCGAGACAGACGACTTTGTCGACTTGGCCAAGACAGCCCGAGAGCGTGCA
GCGGAGACGCAAGAGCGGGCCTACAGCGCTAGGATGCGCCAGCTGCTCGAGAAGCAGGCTAGCGATGTCCGGTTCGTGCG
CAACCTTGGCGTGGGGAGCGGCCGGAGAGACTGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62