GenePrediction:GLEAN_3347 Details

Name: GLEAN_3347
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:790053..791560 (+ strand)
Length: 1508
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:790053..790274 (+ strand)
Length: 222
Type: CDS
Source: GLEAN
Position: GCSC_89:790343..791560 (+ strand)
Length: 1218
>GLEAN_3347 class=GenePrediction position=GCSC_89:790053..791560 (+ strand)
ATGTCTGCCCCAATGCCGTTCTGGGTTCGAGGGGGAGGAGGCGAGCCTCAGGCTTCGGCCCACGAGGGCTACGGCGGCTA
TCACGACCGAGACAAGAGGCCGAGGGAGCTGGCCCCATTCGACAGCCGGCAGCCAGACAGCTATAGCGGTTGGCGCGAGG
CCCAAGGCATCAACCACCCCTTCACACGACCGCCAAGCGCTTCGCAGGATTTCCGGCACTCAGTCAGTTGCGCGGACCCG
CCGATTTCCGGAGAAAGACCTGTACTGCTGACACTGATCTCCATGATAAGGACCCCTACCCCCTGCCACCACCGTCTCCG
TTTCGCGTCTCAGCCACGCCCTCGCCACACCCCGTAGCCAGACGATGGAGGGGTGGCTCGGACTTGAAGGCCTCGTTTGC
GGTCCAGCACCTGCTGGCCGAGCCTTGTTACGGCTCTGCACCGGCGGACACGACCTATGCCGGTCTGTACCGCAGCGAGC
TGGAAAGCCAGGGCAGGGCAACGCCCGACTTTGTCGACTTCCGGCATCGTGATCCGGGCCGCCAGGCGATACATCCGACT
CTAGCACAAGCCTTCGAGTCGTGCTATCTGCCGAACCCGCCGCATTCCCGACCGTCGTCCCATGTCCAGCCGGCTTCGCT
GCCGCGGCCGACGCAGAGCTATGCCGACTGGCAGAAGCAGAGGGAGGACTTGCAGTTTGCCAACGCCGCATCACGCAACA
GCCCACAGCCACAGCCACAGCCCGAACAGCTGCACCTACCGTACCGGTCGCACTTGCACAACACGGACACGCCTGAAGGT
AGTGACATTGGCTGCGATGCCGACAGAGACCTGGACGGTCGGCTCTTGTCAGACGACGAGGCCGTGAGCAGTGTGACCCG
CTGTCTGTTCGGCTTCAACAGCCGGAACCCCGCGTCTCGACATGCCCGCATCCTGCTGGCGCTCATACATCCCAAGACGG
CCGGGGCCGAGTTTGAGCTGGACAACTGCGCGCTGGAGAGCATCTTCCTGGCGGCAAACGAGATATTTTTCAACGGGCGG
CTGACACACCGCGTGCGATGGGGCTGGTCGAAGCCCGGGTCGAATGCCGAATACGACGGCAACATCATTGGGCACACGGC
CCTGCGCAAGGCCAAGATCGGCGGGTTCGAGACTTTTATCCTGCTGTCGACGCCGATCCTCTGCAACCCAGAATACAACC
GGCGGCTGCTCATCTCGGCATTCCTGCACGAACTCATCCACTGCTATCTCTTCATCTGCTGCGGCTGGAGTGCCAGGAAA
TCCGGCGGCCACACGGACGGCTTCCGGGCCATCGCCAACATGATCGACGAGTGGGCGGGCCGAGAACATCTCCATCTCTG
CCACGTAGAGGCGGACTTGGAGCGGTTCCGCCAAGCACCGGATCCGGTCATCGAGCAGGACGGCCACCCGACCAAAGGCG
GGGGGTCGTTCTGTGACAGACTCACGGGGTGTTTTTCCCGACGGAGCTGCCCTCAGAAACTACGTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62