GenePrediction:GLEAN_3348 Details

Name: GLEAN_3348
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:794142..794794 (+ strand)
Length: 653
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:794142..794242 (+ strand)
Length: 101
Type: CDS
Source: GLEAN
Position: GCSC_89:794303..794635 (+ strand)
Length: 333
Type: CDS
Source: GLEAN
Position: GCSC_89:794692..794794 (+ strand)
Length: 103
>GLEAN_3348 class=GenePrediction position=GCSC_89:794142..794794 (+ strand)
ATGAGCTTCAGCATGGACGACTCGCAGAACACGGCATCGGGCGGCCAGGCAGGCGCCAAGCTGGGCGCCAAGAAGGGCCC
CGACTCGCAGAGCGTCAAGAGGTAAGATGCATCGGATCGGGAGATACAGCGTCTCGCCGCATCCCTGCTGACAGGCGGCA
GGTTGCAGACGGAGCTTATGCAGCTCATGACCTCGCCCGCACCTGGCGTCTCGGCCTTTCCGTCGGCCGACGGCAACCTG
CTCTCGTGGCGGGCCACCATCGAAGGCCCCGACGACACCCCTTATGCCGGCCTCACCTTTAAGCTGACCTTTGCCTTCCC
GGCCAACTACCCGTACTCGCCGCCAACCGTGCTCTTCAAGACGCCCATCTACCACCCCAACGTCGACTTCTCCGGCCGCA
TCTGCCTCGACATCCTCAAGGACAAGTGGACGCCGGCCTACAACATCCAGACCGTCCTACTGAGCCTTCAGAGTCTTCTG
GGCGAGCCCAACAAGTAAGGCCCTGTCTCTCGGCCGGCCCGGACGTCTCTGCTAACCCCTACGCGCGCAGTGCCTCGCCC
CTCAACGGCGAAGCCGCCGAGCTGTGGGACAATGACCACGACGAGTTCAAGCGCAAGGTCCTGGGCCGTCACCGCGACGT
CGACGACGAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62