GenePrediction:GLEAN_3349 Details

Name: GLEAN_3349
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:796945..798166 (+ strand)
Length: 1222
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:796945..797123 (+ strand)
Length: 179
Type: CDS
Source: GLEAN
Position: GCSC_89:797201..797876 (+ strand)
Length: 676
Type: CDS
Source: GLEAN
Position: GCSC_89:797930..798166 (+ strand)
Length: 237
>GLEAN_3349 class=GenePrediction position=GCSC_89:796945..798166 (+ strand)
ATGGCAGACCTCCCCGACCACAGCGCTCATTCGCCGTCCCCGCAGCCCGATCTCAATCGGAACCGGCTCCCGTCCCTCTT
TGAGGTGCTCAGCCGCCGGACGCTTCCTCCAGTCGATCTATACTCATTCTACATCTACATGCGAGACCAGCAGCGATCTG
TAGACTACCTCGACTTCTGGTATGCAGCCCTCCTTGCTATCTTCTGTCTGGGCCAGTCCTTATTTTGCTCCTACTGACGC
GTGATCCACTCCATAGGCTCGATGTTGCCCAGCACATGACACTATGCCGTCACTATGTGCGGGAGCTGCGTCGGTCTGTT
CTGATCAGCACGCCAGACGCATCCAAGCGGTCCTCGGCCATTCTTGACAGTCTCGGCGACATGAGCCATCCGGTGGCCGG
CCCGTCCAAGTACCAGACCGACAAGGAAAAGGACCAGGATGCCCAGATGTCTGCATTTCTGCGCGAGGATATGCAGCGCC
CCATGGAATCGCCTCGCAGCGCCGGCACGGCTGCCATCCTCCAGAGTCCTGCCGTCAGTACGTCCCGCGACATCACCGAC
TCCAGCTCTCCCGCCCACACGGTGGCGCGTCAGGATATTCGCAAGTCTGCCGAGAAGATCCTGTACACGTTTCTGCTTCC
CGGCGCGGAGCGTGAGATTGTGCTGCCAGGACCCATTGTCCAGGAAATCACGGCAGCCATAGAGGAGTATGGACGCGACG
ATCCTGAGGTGTTCGACATGGCCAAGGACTACGTCTTCCAGGCCATGGAGCGTGATGCCTTCCCCGGATTCCTGCGCATG
AAGGCCCTTGGCAATCTTATTCCCCCCACGCTCATTCTGCGTCTTATTATCGGCATGGTGTCCATGTTCGGCGCCTTCTG
GGCTGCCTTTGTGCTCATTTTCCTCGACAAATCGCGGCTCACGCGGCTCTATGTGTGTACCTTCCCGACACTACTTTGAC
GAAACATGTACTGACAAGTCCCAAGCTCATCATACCTTTCACGTTCGGAGTGTACTTCCTGGCTTCGTTCCAGTACTCTC
TCGATCCAGTACTTGCTCTGCTAGGCTTCAGCGAATACACCCCCTTCAGTTTCTCTCGCGTGCGAGAGCCCTTCGTGCGC
AAAATGCTGGCCAAGCGGGCTTTAGTTGTTCTTGCCGTGACAGTTTTTGTCGATGCTGCACTTCTGGTGCTGTTCATATT
CGTTCCGGGGAAGATGCTATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62