GenePrediction:GLEAN_334 Details

Name: GLEAN_334
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1132119..1133308 (+ strand)
Length: 1190
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1132119..1132629 (+ strand)
Length: 511
Type: CDS
Source: GLEAN
Position: GCSC_167:1132698..1133308 (+ strand)
Length: 611
>GLEAN_334 class=GenePrediction position=GCSC_167:1132119..1133308 (+ strand)
ATGGTTCGCCTCGGAGCTCTGCTCATCGGCGGCCTTGCCGTCATCGCCTCGGCCAAATCTTCAGTTCTGGACCTGCTGCC
TTCCAACTTTGACAGCCTGGTCATTGACTCGGGCAAGCCAACACTGGTCGAATTCTTTGCCCCGTGGTGCGGCCACTGCA
AGAACCTGGCCCCCATCTACGAAGACCTGGCCGATACCTTTGCCTTTTCGGACAAGGTGCAAATTGCCAAGGTCGATGCG
GATGCCGAGCGGTCTCTGGGCCAGCGGTTTGGCGTTCAAGGCTTCCCCACGCTCAAATTCTTTGACGGCAAGAGCAAGGA
ACCTGTCGACTACAACAGCGGCCGTGACCTGGACAGCCTGTCGGCATTCATCACCGAGAAGACGGGCGTCCTGCCCCGCA
AGAAGTGGGAGGCGCCCAGCAGCATCGAATTCCTGACGGATGAGAGCTTTGCGAAGGTCATTGGTAGCGACAAGGATGTG
CTCGTGGCCTTCACAGCGCCGTGGTGCGGACGTACGTATACCTGATCACTGGGAAGAGTGGGGGGGTTATATGCTGCAAT
AGAGCTAACACGGATGCAGACTGCAAGAGCCTGGCTCCCACTTGGGAGAAGTTGGCGACGGATTTTGCCAACGAGGACGG
CGTCGTGGTCGCCAAGGTGGATGCCGAGGCTGAGTCGAGCAAGCAGACGGCCAAGGATGAGGGCGTGACGTCGTACCCGA
CTATCAAGTTCTTCGCCCGTGGCAGCAAGACGGGCGAGGCATACTCGGGCGCGCGCTCGGAGGAGGAGCTTGTCAAGTTC
ATCAACAGCAAGGCCGGCACGCACCGCACTGTGGGCGGCGGTCTAGACGCAGCGGCTGGCACTGTGCCAGAGCTCGACAA
TATCGTGGCAAAGCTGGCCAGCGGCCGGCAGTCGATGCAGGAGGCGGCCGAGGCGGCCAAGAAGGCGGCCAACGTGCTGC
AGGCTGATGCCAAGAAGAAGTTTGCCGAGTACTACGTGCGGGTGTTCGACAAGCTGAGCAAGAACGAGGGGTTCGTGTCC
AAGGAGTTGGCCCGGCTGCAGACCATCCTGTCCAAGGGCGGCCTGGCACCGGTCAAGACGGATGAGCTGACCAGCAAGAC
CAACATCCTGTCCAAGTTTGCCGAGAACATTGCCGACAAGGAGGAGGAGGTGGCCAAGGACGAGTTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62