GenePrediction:GLEAN_3350 Details

Name: GLEAN_3350
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:801403..808090 (+ strand)
Length: 6688
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:801403..801515 (+ strand)
Length: 113
Type: CDS
Source: GLEAN
Position: GCSC_89:801586..805035 (+ strand)
Length: 3450
Type: CDS
Source: GLEAN
Position: GCSC_89:805517..805559 (+ strand)
Length: 43
Type: CDS
Source: GLEAN
Position: GCSC_89:805614..807393 (+ strand)
Length: 1780
Type: CDS
Source: GLEAN
Position: GCSC_89:807558..808090 (+ strand)
Length: 533
>GLEAN_3350 class=GenePrediction position=GCSC_89:801403..808090 (+ strand)
ATGGCGCCTTCCTACATAAAAGTCCCTCCAAGGGACGCAACGCTGTTGAGCGCGACAAATGGTGCTGCGACACCACACAT
GGCGACTACAACACTTAAAGTTGACGGCATGACGTGAGTTTTTCCCCCACTCGCATTAAATTCCTCTCCTGAGACAGGTC
GGACTAACCGATGGGCTTTAAAGCTGCGGTGCATGCACTTCCGCTGTTGAAGCCGGCTTCAAGGGCGTAGACGGAGTGGG
CAGCGTTTCTGTCAGCCTTGTGATGGAACGAGCGGTCATCATGCACGATCCACGACGCATAGCCGCAGACCAAATTCGCG
ACATCATCGAAGACCGGGGCTTCGACGCCGAAGTTCTCTCGACCGACCTTCCGTCGCCCGCCATCGACCGGTCCTACGAC
GATGCCAACGATGCCGAGGCCGCTGCGGGCAGCTGTGTGACGACGGTGGCTGTCGAAGGCATGACCTGCGGCGCGTGTAC
CTCGGCGGTTGAGCGTGGCTTTGATGGCGTTCCTGGCATCAGGCACTTTAGCATATCGCTGCTCTCCGAACGGGCTGTGA
TCGAGCACGATTCAACACTGCTGAGTGCAGAGAAGATTGTGGAAACCATTGAGGACTGCGGGTTCGGCGCAAATGTCGTG
GAGACGAAGCAGATGCGGCCTGAGAAAGGCGGCGGCCTGGGCGGGCAAATGGCAATTCCAGCGCACGTAACGACGACCGT
GGCCATCGAGGGCATGACCTGCGGTGCCTGCACGTCCTCCGTGGACGGGCTCTTCAAGGGCGTGGACGGCGTGCTGCGGT
TCAACATCAGCCTGCTGGCTGAGCGGGCGGTCGTCACACACGACCCGGCCAAGCTGTCGACGGAGAAGATTGTGGAGATG
ATCGAGGACGGTGGCTTTGGGGCGACAATCGTGTCTTCGGTGCCGGATGACGCGACCGGTGGTGGCCAGGCCAAGGGCTT
CGCCACGGCTCAGTTCAAGGTGTACGGGACGCCCGATGCAGCTGCGGCCAAGAAGCTCGAAGAAGGCCTCCTCGCGCTCG
CGGGCGTGCAGTCGGCAACGCTGAGCATGGCGTCGTCACGTCTGACAGTGGCGCACGTGCCGAGCGTGACGGGCCTGCGG
GCGATCGTCGAGGTGGTTGAAGCAACGGGGCTCAATGCGCTTGTGGCGGACAACGACGACAACAACGCGCAGCTCGATTC
TCTGGCAAAGACGCGTGAGATCAACGAGTGGCGGCGGGCGTTCAAGTTGTCGCTCAGCTTTGCGGTGCCGGTCTTCCTGC
TGGGGATGGTGCTTCCGATGCTGCTACCGATGCTGGATTTGGGTTGTTTCACGGTGATTCCAGGCCTGTACGTTGGCGAC
ATCATCTGCCTGGTCCTGACGGTGCCGGTGCAGTTTGGCATCGGCAAGCGGTTCTACGTTTCGGCATGGAAGTCGGTCAA
GCACGGCTCGCCGACGATGGACGTTCTCGTTGTTCTGGGCACGTCGTGTGCCTTCTTCTTCAGCATTGTGGCGATGCTGA
TCTCGGTCCTCATTGCGCCGCACAGCCGTCCGAGCACGATCTTCGACACGAGCACGATGCTGATCACGTTCATCACGTTC
GGGCGCTTCCTAGAGAATCGTGCCAAGGGCCAGACGTCCAAGGCGCTGTCGCGGCTGATGTCTCTGGCGCCATCGATGGC
GACAATCTACGCCGACCCCATTGCGGCAGAGAAGGCAGCGGAGGGTTGGGATACGGTGGCCGGCCGAGGCGGACCGAAGA
CGCCGCTGGTGGACGGCAACGCGGCAGAGGAAAAGGTGATTCCGACGGAGCTCATCGAGGTGGGCGACATTGTGATTCTG
CGACCGGGCGACAAGATCCCAGCGGACGGCGTGATGGTGCGCGGCGAGACGTATGTGGACGAGAGCATGGTGACGGGTGA
GGCGATGCCGGTGCAGAAGAAGACGGGCAGCTTCCTGATCGGAGGCACGGTGAACGGCCACGGCCGTGTGGACTTCCGGG
TGACGCGAGCAGGCCGCGACACGCAGCTCAGTCAAATTGTGAAGCTCGTGCAGGACGCGCAGACGACGCGGGCGCCGATC
CAACGACTCGCCGACACGCTCGCAGGGTACTTTGTGCCGACGATTCTGACACTCGGATTCCTAACGTTTGTGGTGTGGAT
GGTGCTTAGTCACGTGCTTCCGAACCCGCCGAAGATTTTCCTACAAAACGCGAGCGGCGGCAAGGTGTTTGTGTGTGTGA
AGTTGTGCATCTCGGTGATCGTGTTTGCATGTCCATGCGCGCTGGGCCTGGCGACACCGACGGCAGTGATGGTGGGCACG
GGTGTCGGGGCCGAGAACGGGATTCTCGTCAAGGGTGGAGCAGCGCTAGAGACGGCGACCAAGGTGACGCGGGTGATCCT
GGACAAGACGGGCACGATCACATACGGCAAGATGAGCGTGGCAAGCGTGATTCTGGCGGCAGCGTGGCAGGAGAGCGAGC
AGCGGCGACGGCTGTGGTGGACGGTGGTCGGACTGGCCGAGATGGGCAGCGAGCATCCGATCGGGCGAGCAGTGCTGGGA
GCAGCGAAGACGGAGCTGGGGATGGACCAGGAGGGCACGATTGACGGCAGCGTGGGCACGTTCGAGGCAGCGGTAGGCCG
GGGCATCAGCGCGGTGATCGAGCCGGCGACGAGCGAGCGGAAGCGGTTCGACGTGCTGATCGGCAACACCCGGTTCCTGC
GCGAGAGGAGGGTGGAGGTGCCGGAGACAGCGATCTCGGCGTCGGAGGAGAGCAACACACGGGCAGCAGCAGCGTTTAAG
CGATCGTCGGCGCAGTCAGCAGGAACGACGAACATTTTCATCGCGATCGACGGACACTTTGCCGGCCACCTCTGTCTGGC
AGACACGATCAAGGAGGGGGCAGCAGCAGCGATCTCGGTGCTGCACCACATGGGCATCAAGACGGCAATGGTGACGGGCG
ACCAGCGATCGACAGCGGTGGCGGTAGCGGCAGCGGTGGGCATCGCAGCCGAGAGCGTGTTTGCGGGAGCGTCGCCGGAG
CAGAAGCGGGCGATCGTGGCCGAGCTGCAGGCACAGGGCGAAGTGGTGGCGATGGTGGGCGACGGGATCAACGACTCGCC
AGCGCTGGCGACGGCAGATATCGGGATCGCGATGGCGTCAGGTACTGACGTGGCGATGGAAGCGGCGGACGTGGTGCTGA
TGCGGCCGAACCGGCTGATGGACATCCCGGCCTCGCTCGACCTGGCGCGGTCCATCTTTGGGCGGATCAAGCTGAACCTG
GCGTGGGCGTGTGCGTACAACATCGTGGGGCTGCCATTTGCCATGGGCCTGTTTCTGCCACTGGGGCTGCACCTGCACCC
GATGGCGGCCGGTGCGGCCATGGCGGCGTCCAGCGTGAGCGTCGTGGTCAGCAGCCTGCTGCTCAAGTTCTGGCGACGGC
CCGGCTACATGGATGTCGATCTGTACGACGAGCGTGGCGTGCCCAAGGCCAGTCTGGGCTGGCGCTGGAAGACGCGTAGC
ATGGCGGCCTGGGCCCGCGGCGGGCTCGAGGACGTCTACCTGGCCGTGCGCGGCCGGTGGTGGGCGGACAAGGAAGACGG
CGGATACGTGCCGCTGGCGAATTTGGATGGTATGTGAGTTGGTGAGAGTGGGTGAGATGTGGAATGGGTGAGGGTGTGGG
TGCGCTGGGATGCACAGCTGTCAGACAGCTTCCAGGCTGCTATCTGCCTTTGCTTTGTTTATTCTTGGCCGGCGTTGCGG
TATAGCTCTGGATGGATTTACGATCGATACCTCGTAAGGATGCTGTATTCAAAGGAGTTAATTAGGGAGTACTTTACATG
TTCTTATTTACATAGTCGGTGTTATGAGGATATGCGTTTATTCAAACTCCCTACGTACATAGTACTTCATATTATTACAT
TATGAGTACTCCGTATTCTGTGACCCACCTGTCACAATGACGTCGCTTACATCCGGCACGTGGGCCTAGACCTCCAAATA
TTCTGCATCTACTAGTCTCGAGCAGTCCATCATTTACTCCGTACTTCAGCAGCTCTTTCGACAACTGACGAAAGGCGAAG
ATCGGTCATCTAAGCTTCTCTTATTGATTGAAAGCCGCCCGGAGCAGATGCCACCAAAACGAGATCCATCGGTTCTGGTG
CGTCGATCCCAACCTCTCTTTGCGTCCGTGTCCTGACACCTTCATTTACAGGTTACCGATGCACGTGAGCGTCCGCCATC
GAGCCAGGGCAGATCCGGTGCGCAGCGGCCCAGCTCTTCGCAGGGCAATTCGTATAGCGTCTCCTCGTCCTCGTCCGCCA
GCCAGCGACATTCGATGCGCCACGTTTCTGTCGACAGCATCCTCCAGAACGCGACGGCCATTCCGTCTGGTCAGCCACGT
GGACCGCCGGGGTCACAACGCCTGGTGCCGGCATCCGGTCTGCCGGCAGCCGCAGCCGCAGCTCGACGACGCGGCCTCAC
GAGACGGGGCAGTGGCTACGGCGGTGCAGCTGGTGTCGGCAGTGCAGCCGGACTGCTGGCCGGGAGTACCGGCGTAGGAG
GGACAGGCATCGGGGGGTCAGCTGGAATCGGTGGTGGGCCGTTGCTGTCGCGGGCGGTGCTACCCAACATGCCGTCCCGC
ACGACCAAGATCTCGGAGAAGTTGGTGCTGCTGCCGGAGACGGGTGACGAGACGACAGGACCTGGCTTTGACGATGAAGA
CGAGGACGAGGACGAGGAAGAGGAGGCAAACGAGGAGAACGGCCTGGATGTGGACATGACCGACGCGGCCGAGAGGGCGC
TGGTGGCGGCGTTGGCCAGCGAGAATGCCGAGGCAGCACAGCGGGCGCTGCACCGGGCACGCATCGAGGAGGGCGGCGGG
CTATACGACGGGGCACGTCCGCCGCGCGACGAGGAGCTGGACGTGCTGCGAAAGCGTGGCGGGATCCGGGGCAAGAGCTA
TGCCGAGCGGCTGCCCAAGGGCCAGCGGACGGAAAAGGTCGCCCGGCTGACAGCCTACTGCACGGCACAGGCCTTCAAGA
TGCGGGCGACGGCCGAGTTTCTGCGCGCGCGCCACGCTGCCAAGGCCAAGCTATACGACGACTGCCTCTACACCGTCTAC
CACCTGCCGCTGCTGCCCGGCCACGACGGTTTCCGCGTGCGCAGCCGGCCGATCCTCAAGACGCCCGGCACCGGCAAGAC
GGTGCTGGACCTCGAGATCGAGCGCAGCGAGCGGCGTGACGAGCACATGGGCTACGACTACGGGTATGCGCACGGGCACG
AGGGACACGACGAAGGACACGACGGACGGCAGCACGCGGACGGGGCTGTCAAGAATAGCCACAGCGGCCAGGCAACGTCT
GGTGGGGACGAGGATCAGCAGCAGCAGCAACAACAGCAAGAGGAGCAGCCACAGCGCATGTACCCCGTCTCCTCTTCTTC
GGCGACCGAGGCGGCAGAGATCTATCTGGACAGCCCACGACCGCCGGTCAACCAGCTGGCGCCCGAGGCGAAGCATTTTG
CCGAGATGTTTGTCTTCTCGTATGGCGTGGTGGTGTTTTGGAACTTTTCCGAGCATCAGGAGAAGGCCATTCTGGCCGAC
CTGGCATTTGCTGAGAGCGAGACGACGGGAACGGGGACGAGCAGCGAGAGCGGCAGCGGCGTGGCGCTGGCAGTGCGGCC
GCTCGATCAGGCCGACTTTGAGACGGAGGAGTTCCACTTTGAGTACAGCGGCAGCGTGCAGCGGCCGCGGGTGTTCAACG
ACATGATCACGCTGCTGCCACGGTCAGACCACATGGTGAAGCTGACGATCAGCCACGCGATCGCGCAGAGCACGAAGCTG
TGCTTCTTCGAGGAGAAGATGTCGCAGACGATGCAGAATGCACAACACGTGCCGAAGCAGCTGGCGTTGACGGGTGAGCT
GAACATGTCGCGGACAGAGATTGTGAAGATTCTGGGGCTGTTGTTTAAGAGTCGGGTGGACATTAATCTATGTGAGTATG
GGGAGAGAAGAGTGGGAAAAAGGAGGAGTGGGAGAGAGAAGGAGTGGAAGAGAGAGAAGGAGTGGAAGAGAGAGAAGGAG
TGGAAGAAAAAAGAGAGAGGGGGGGCGGAAGAAAGAGAGAAAGAGAGAGAAAGAGAAAAACGCTAACTATCACAGCCTCA
AACATCCTGGACGTCCCCAACTTCTTCTGGGACGCTGAGCCGACACTGCATCCACTCTACGTAGCCATCCGCGAGTATCT
CGAGATCGATCCGCGCATTCAGGTGCTCAACGAGCGCTGTCGCGTCTTCCTTGACCTGGCCGAGATCCTGGCCGACTCGG
TGGCCGACGCCAAGATGAGCTACATCACCTGGATCGTCATTATTCTGATCGTCATCAGCATCTGCGTCACCGTCGCCGAG
GTTCTCCTACGCTTCGCCCTGCTGGAGAGGGGAAAGGAGCGCAACCGCACCTGGGCGCCCAACGGCAGCAGCAGCGACAT
CGTGTCTGTGCTGCCACCGGCACCACCGGCCCTCCAGATCCAGACGATTCGAAGCGGCAGCAGCAGCGGCGGCCTGGGCG
ACCTCGACGACCTCAGCAAGAGACCGACGCTCGACGAACTGCGGGCATGGGGTGCCCTACTGAGCTCACAGGAGCGGGCA
GCCGTGTGTGGCAGCGACTTGGTCGGGCAGACGTTTGCCGGTGTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62