GenePrediction:GLEAN_3351 Details

Name: GLEAN_3351
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:810059..817060 (+ strand)
Length: 7002
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:810059..810442 (+ strand)
Length: 384
Type: CDS
Source: GLEAN
Position: GCSC_89:810501..810694 (+ strand)
Length: 194
Type: CDS
Source: GLEAN
Position: GCSC_89:811152..812386 (+ strand)
Length: 1235
Type: CDS
Source: GLEAN
Position: GCSC_89:812669..812860 (+ strand)
Length: 192
Type: CDS
Source: GLEAN
Position: GCSC_89:812939..813483 (+ strand)
Length: 545
Type: CDS
Source: GLEAN
Position: GCSC_89:816369..816526 (+ strand)
Length: 158
Type: CDS
Source: GLEAN
Position: GCSC_89:816603..816648 (+ strand)
Length: 46
Type: CDS
Source: GLEAN
Position: GCSC_89:816824..817060 (+ strand)
Length: 237
>GLEAN_3351 class=GenePrediction position=GCSC_89:810059..817060 (+ strand)
ATGATCGCCAAGACGGTTCTGCCTCGTGTATTGGTGCCTGTGCGGCCTCGTCGGCAGCAAAACTCGGCGCTGTCATTTCA
CAGCCCTGCAAGCATTCTTCCTGCTCCTCTATCTGCCCTTCCTCCTGCTGCTACTGCCACCCTCACCCAAGCCGCACCAT
CCCGCACGAGCCGCGACCGGCCGCCCCTCCAACGACCGTTTCTGCAGCCTCATCCGAGCGCAGCCGCGCGATTCGCCACC
ATGTGCATCGTCTTCACCTGCGGTGAGCACACCTTCCGCCGCGAGATCGAAGGCTACGAGGGCATCATCTGCCGCTGCTA
CAACTGTGGCAACTACAGCGGCCATGTCATCAAGACCCATCCGTGGTTTACCTTTTGCTTTGTCGTGAGTCTCCTGTCTT
CTGTCTCTGCTTTGGCTGTCCGCTGACCTGCCTCAACGCCAGCCCGTCATCCCGCTCTCCTTTCACGGCTACGAAGACAT
CAGCTGCCACATCTGCAACTTCTCCCAGCCGCTTGAGAGCCGCCAGGACGTGCAGGCCATGCGCAACGGCGGTGCTGGCG
GACGGCCAGGCGTCCCTCTTCAGCCGCATCCGGAAGCACAAACACAGCAGCCGCCGGCGCCGGACGGAAACATGCGGTAT
GGTTGACTACGGCCGCCCGCCCTTGGTCTAGGCGCAAGGACCCTGGCGGTATTCTGAGGGGCAGTTCCTTTCGTCTTGTT
TGTATTCTTATCGTTCTGTCCCTTCTTTCTTTGTTGGCGCAACGGAGTTTGGCGATCGTACCTTGACAGGCAAACGGCGT
GGCTCTGCACGGGACTGGGTAGCATAGGATTGGATGGAAGTGTTTGGTGACTGTGTAGTCTGATAGGATTCTCATTAGCA
TACGAGTGTACACCTACTATTGTCACGAACCATCCTGCAGTGCTGAATGGCCGGTAGAGCGCCATTGTTTAGCGGCGGCT
GCTCCTGGAGCTAATCCGGATTAGCGCTCGCACCGCCCCCACAGGCCCCCATCCACGGGGCTGCTTAGCGCATCGAATTT
TTTGACCCGACAGCCTGCATCTCTTCTGCATCGACTGCCGTCCTACGCAACAGGACCAGCCGCCAGCAGACCGACGACCG
AGCGCAGACGACCGGGAAGCGTCTCCATTCCTCCTCATCTGCAGGTCGTGTTGAGCTGGACGTGCGTGTGCGTTCTCGCC
CGGCCGCAGGCGAGCGGAACCTCGACGCAGAAACGATGCTGTACGACCTGAGCATTGCCTGGACGCCGTCCACGACGACG
GCTGAGCTGGAGGACACGCTCGCCATGAGCTCTGAGCTCGGCTATGACGTCGTGGCGCTGGATCACGTCTACGCCGGCCC
GGTGCCGTCGACCGTGACCAATCCGCTGCCCTTGCTGCCAGCAGTAGCAGCATCGACAACGACATCCACCACAACCACAT
CCAACAGACCGGCGAGCCGGCGGCTGCCTCGCATTCTTCGCCGCGCCACCGTTGTCGTGTCCGACATGACGGTCAACCAC
CGGCTGGCCGCCGTGGCCGCGGCCTACGACCTCGTCGCCGTGCGGCCGACCACCGAAAAAGCCTTCCAGGCCGCCTGTCT
CAGCATGACCGAGCCGGCCCTCATCAGCCTCGATCTGACGACGTACTTTCCCTTTTTCTTCAAGCACCGCGCCGCCATGG
CCGCCGTCCGCCGCGGCGTCCACTTTGAGGTCTGCTACGGCCAGGTGCTGCGGGCCGACAGCAGCAGCAGCGGCAACACC
AGCAGCTCGGCCAATCGTGCTCGCGCTCTCTTCGTCGCCAACCTGGCCGGCCTCCTTCGTGCGACACGCGGTCGCGGCAT
CGTCGTCAGCTCCGGCGCCCTCATGGGCCGCGGCAACAGCAACGGCGGCGGCGGTGGCGGCGCGCTCGAGCTGCGTGGCC
CCGCCGATGTCGTCAATCTGCTCGCCGTCTGGGGTCTGCCGCCCGATCGCGGAATCGACGCCCTCAGCGGACTACCGCGC
AGCATCATCGCTAACGAGGGCCTCCGGCGGCGCGGCTTCCGCGGCGTCATCGACATCGTGCAGACGGCTGAGAACAGCAG
CGTGGCTGCTGCTGCAGGAGCAGGAGCACAGCTGAAACAACAGAAACAGCTGAAACAACAGCAGAAACAACAGCAGAAAC
AGAAGCAGATACAGGGACAGGGAAACGGTGCAGCTGGTCACAAACGGAGGGCCAGCGAAAACGGCGGCGGAAACGGCAAC
GACAACACCAACGGAAACGGAGAGGCTGCTGAAACGGACCAGCAGAAGAAGACGGCAACCGAGCGACAGCCAAAGAAGCA
GAAGAGAGGTTCCGGGCCGTAGCAGCAGACTGATTATACCCAGGCGTCAAGGAAAAGAAAAGAAAGGATACAAAGAGTCT
GGCTCTGTATTTCCTATGTAGGCCCTCTCTGGGCAGATTATAATACAAAGACTCGATATAAATGACAAAGAACAAAAACA
CAGAAGCGGTGGGCGAGAGAGGCCTCGGATCCAGGCCGCCGGACAGAACACCCAGTCTCCCTTTATATACAAGTTTCCTG
GCTTCCTTGGATCTATTGTCGTCTTGACTTGTCCTTCTGCCGTCTCTCAGAACCCACGTTTTCAACCCCCTTGTCTCCGG
CTCAAACACCCGTCGACTTTGCCAGGCTGCCCAACGTCAGCACATCGGTGAGCGACAGTCCGGAAAAGTCGATCGACACT
GCTTGCGCACCGTTGGCGACACCCAAGGTTGCTGCTGCTCCCGCCGCTGCCGTCGTGGTCGCGCCCTCCATTCCGAGGAC
GAGTGCTGTTTGGAGGGCTATATTGTTAGCAAGCCAATCCAGGGGTTTGTCTTGTGGTCTTGTGCATCACTTACTGGCAG
CAGCAGCAACGGTGCTGGTAGACGGAACAAGGGCAGCGCCTACGGCCGCCGTTGTCGTAGTGATTGCGAAAGCGGTGCTA
GGCGCAGTGCTGGTTGCGGCGTCCAAGGTCGAGAGGATCGAGGGAAATGTGGCGACTGAGATGACCAGGGAGGATGAGGT
CGAGGTGGTCGGGATGGACGAGAATATGGAGGTCGAGAGAGTGGAGGTCGAAAAAGTCGAGAGAATGGAGGTCGAGAAAG
TTGAGGCTGGGAAAGTAGAGGCAATCGAGGATGAAGCAGTTGTAGCAGTTGTAGCAATTGGGGCGACTGAAGCAATTGTG
GTCGAGATAGTTGAGGCAGACGTCGAAGCAATCGAAGCAACTGAAGTTGAAGCAACCGGAGCAACCGAAGCGACCGAGGC
AGCCGAAGCAGTTGATGCAATCGAAGCAACTGGAGCAACCGAAGCAGTTGATGCAATCGAAGCAACTGGAGCAACCGAAG
CAGTTGATGCAACCGGAGCAACCGGAGCAACCGAAGCAACCGAAGCAACCGAAGTCGTCGAATTGGTAAAAGTTATCGGG
GCCACACTCGATGCTGTTGCCACCACAGCCGCTGTTGTTGATGTTGCCACCTCCGTTGCAGAAGCCGCTGTCGTTGTGTT
CGAGAAACCCACCGATGTTGCCAAGGCTGTTGGGGTTGCTTGAATCGTAGCTGCCGTTGACGTCGCCGCCGGTGTCGATG
CCACTGCCACAGTTGACTCCGTGGTGGACGGTTCTGCCGGCGTTGTCGATGTTGTCGATACCGGCGTCACGGCCGTCGAT
GTCGTCGCAGCCGTTGCCTCTGTTATCGACACCACCGACACACCCACGCCGCCATGAGGTCCAGTGGTTTCAGCTGTCGT
TGGCGCCACTGTTGTCGCCGCGGAGGCTGTGCCCTGGGCAGCGCCATCTGCGACAACCTTGCTGGTCGAGGTGCTAGCAG
TGGTAGAAACAGAAGAAGTAGGAGCAATAGTAGCAGCAGAAGTAGTAGCAGCAGTAGCAGCGGCAGATGTCGCCTTGGTC
TTGGTTTTCTTGGTCGTCTTCGAGTCAGCCGTTGCAGCAGCTGTGCCGTCAGTCGCCGTTACGCTGATAAAGTCGGTTAT
CGTTTTCGTGCTGTCCTTGGCCGTGTTCTTGCCACCGTCTGTTGTCTTCGTACTGCCCTTGGCCTTGGTAGTTGTGCCCT
CGAAGGCGATCGTAGTGAGTGCCCCGTGTCCTGTTAATCCTGCTGCCGCCACTGCCGACAATGCTGCTGCCACATCTGAT
GCCAGTGCTGCTGCTGCTGCTGCCGCCGCTGCGCCATTGTTGTTATGGCCGTCGTTGCCTTTCAGCTCGTTCTCTGCGGA
CGGCAGGTCCCTTCTGTGCCATTGTCCGGCCCGGCCAACGGCGGCGGCCTGGCTGAGCGATAGGTAGCTGAGCAGAAGCA
GCGGTGTGCTGGCTATGGATGCCTTCATCCTGTATTATGCGCAAAACACAGAAACAGACGAGAAGGGAAAGAAGTAGGGT
CGAACAAAAAGGCAAAGGCTGTGCACACCACAGACCAGCCGTGCGAGCGAGAGCGGAAGAAGAGAAAAAGAAACGGCGAA
ACAAAATTGGAATAGACAAAAAAGCGAGGAGAAGAGAACGAAAATGACAGGCTCCCAAAGACCAGCTGGGTTGCACGAAA
CCGATGTAGATCGGGAAAGAGAAAGAAAGATGGAGATCGCGGCGAGAGTTAAAGGAATGTGGCTCGTAGAGAGGAAACAC
CCAGCAGACCTAGTGCCAGATCCAAAACGAGAGAGGGTCCAGACTGAGATGGAACACAATGGGAAAAGAGAAAAAGTGTC
GAGAAACAAAACAGAAAGGGAATATGTGGGCGCAAGGCTCGATTCCATTCTGCGCAGCTGCTGCCGGGCGGTCTCTCCTG
GTCTCTCCACCACGGCCCCTCCTCTTCTCCGTCGCTACATTGTCAGATACGACACCGATGATGAAAATGCTTTTTTTATC
GTCTGCATGCTTCGTATTCTCGCGCTCTTCTCTTCTCGGCCCAGCCCCGTCTTCGACTAGCACGCTGTCACATTGGGCGG
GAGAAGAGCACAGGCATGCAGGGACGAGTGGGCCGCCGGTACTGCGTCCGGGCGGCATCCCTCGACGTGATGCAATCACT
GCTGCTGTTGCTGTGATTCCTGCAACAATGGATGGTGACAAACTCTGCGCTCTGGATCGCACAAAGCTGCGCGTCACAAG
AGACGCCCAGCATTGATGGAGGCTCTGCTCCGTATCTTACCACATCACCGGCGGCCTGGCTGAGAGGCGCGGAAGAAAAG
GGGGCAGCCGTTGCATTCATAGGTCGATGTGTGGATACGGAAGGCCATCTGAGACGGTGGTCGTGACCGGATGCGTTTGG
GAACGCAGGGGCCTCTCAGCAGCGCCGACCAACTGGACGGCAGTGGGGGAAGGAACCAGGGAGTCACTTCCCGTTTGGGC
CAAGACTGCCTGCACGTGCATGAGAGACGTGTTTCGCTCGGCCGTGTCAGCTGGGATGCGAGACAACATGTGTAAGATGG
GAAAGAACTATCCTGAGGCTCTGCCTTGTGCATGGCGCTTGCTTGCATCCTTGGGCCAGGTGTCAGGGGCCAGAGGTAGG
CTTATATTTTAGCAGTGTCCTTAGCGGCCCATGACTACGAACGAAAATACAGGGGAGTGGTCGGCTCGCCTAGACGGCCA
AGCCTTTTGCACTATTGCGGTTCTGGCCTGTGGCCCGTCCTTCAATTTGCCAGGTCCATGTTGTCAAGGTGGCGGTGTTC
CGAGTAATAGTAAAAGCTTATTCTTATAAGCTCGCAGTCTGCACAAGGCAACAGATCACATCTCAGTCCAGCTGGCATTC
TATACATAGTACGAACCGAGTGCAACCCAAGCGGCGCAGAATTTAAGCAGACCGCCTGCCGACGTAGATCTGTGCTGTCG
ATCTCTTTTGTTTCTTCCGCAGCTCTGGCGACTGTCTCAGCTCACACTATGTACTCCGTAAGACTTCTTACTTGGCACTG
CTGTCGTTTCTCACCCTAGAGTATGCATACTCTTACACACATAAAGAGCAATCCATGCCACGTGATCACGCGGCATCGCT
CTCGCATCCCGCTCCTTGCAGCGGGTCCTAAGATACTCCTATCGCCAGCCCGGCATGCAGAAAGTTCAATTTCAGGTGAG
TCATGAATGCTCTTATGTCCTTTTTTTTCTTAATCTCAATGAATCTCAATGGCATTGCCATATAATGATAGACATCGTTG
GCGCTCACTTCTGGGAGAACTCGCGTCTTTGCGTCCTGTCCAATTTACGCGACCAATGTCCAAAATCGTCACCTGATCTG
AACGTCATTTTCGCATTTACAAAGGCTGCCCTGTATTATTGTTTTCGCCACAATGAACGCCCGGTGCCAGTGCGGTGCTG
TCACCTTCAAGACGCCCCTCGAACAGCCGTTGGCTCTGTACATATGTCACTGCCATACCTGTCGCCGCCAGACCAGCTCT
GCTTTCGGCACGAGCGCCATCTTCCCACGGTTTCCGTTGCCAGATGCGAAACTGCTGAGTTGCTATACGTGAGTGTAGTT
AGAAGAGGTCCCATAATTTGTATAGTGTGTATTTGTTTGTTTCCCTGTGCACCTCTGCTTACAGCGCTCTGTTCCAGTCG
CCCGACTGCGTCAGGTCAGACGTTATACTGGTAAATACAAAGGAGCAATGTCACGAAGTAGGCGTACAAGTGTTGATTTT
TTCAATTTCAGCTACTTTTGCACAAACTGTGGAACACGGCTCATCCACACCACTCCCGTGCGTTCAATCCCATATCTTTC
CTGGCCACTGATACGGGTTCTAAACACGGCCGACTCTCGTTGTAGGGCAAAAACGTTGTCTCCGTCAAGGGCGGCTGCCT
GGACGGTCTCGACTGGGATAAGGCCGTCCACATCTGGACCAAGTCCGCGATGGTGCCTATTCCTGAAGGCAACGAGAGCC
ACTGCGGAGAGACTGCCTTCACCAGCTACAGCTACGGCTCGAGTCAGGAGGAGCTAGATCAGCCGGCCGAGCTGATGGGC
AGTGGCAGCCATCCGAGCGAAGAGAATATGGACTCGGTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62