GenePrediction:GLEAN_3353 Details

Name: GLEAN_3353
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:821740..824998 (+ strand)
Length: 3259
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:821740..822369 (+ strand)
Length: 630
Type: CDS
Source: GLEAN
Position: GCSC_89:822516..823447 (+ strand)
Length: 932
Type: CDS
Source: GLEAN
Position: GCSC_89:823510..823599 (+ strand)
Length: 90
Type: CDS
Source: GLEAN
Position: GCSC_89:823936..824091 (+ strand)
Length: 156
Type: CDS
Source: GLEAN
Position: GCSC_89:824149..824326 (+ strand)
Length: 178
Type: CDS
Source: GLEAN
Position: GCSC_89:824546..824998 (+ strand)
Length: 453
>GLEAN_3353 class=GenePrediction position=GCSC_89:821740..824998 (+ strand)
ATGGCTCCCGATCTCAACTCGCTGCCGACGTCGCAGTCTGGGCCCAGTGCCTCCCGGACGCGGAAGCAGCCCAACATTCT
CTATGTGATGGCGGACCAGCTGGCAGCGCCTCAGCTCAAGATCTACAACGAGGAGTCGCAGATCCTGACGCCCAACCTGG
ACGCGCTGGCAGCCAAGTCGGTGCAGTTTGACTCAGCCTACTGCCCGTCGCCGTTGTGCGCGCCCTCACGCATGAGCATG
ATCACGGGACGGCTGCCCATGGCCATTGGCGCATACGACAACGGCGCGCAGATTCCCAGCGACATCCCCACGTACGCACA
CTATCTGCGGCTGAAGGGCTACGAGACAGTGCTGGCAGGGAAGATGCACTTTGTGGGTGACCAGCTGCATGGATACGAGA
ACCGGCTGACCAGCGACATTTACCCGGGCGACTTTGGCTGGGTGGTCAACTGGGACGAGCCAGAGACGAGACTGGAGTGG
TATCACAATGCCAGTTCGGTGGAGCAGGCTGGCGTATGTGTGCGCAGCAACCAGCTGGACTACGACAACGAGGTCATGTA
CCGGTCGGAACAGTTTCTTTACAACCACGTGCGAGCCGATCCAGAAACCCGCCGGCCTTTTTGCTTGACGGTATGTATGG
CGTGTGGAGAGGAAGACTAAGCATGCGACTGTTCGAATGGGAGTAGTCGTAGATGTCTGGAAGAATGAGCCTCTCCGCGT
AGGCTTGTGAGGTGCAGCATGCAGACTCACGTTTGCTAACGCCATGGTTCTGATAGGTTTCACTCACACACCCACACGAC
CCGTACACGATCCAGCGCAAGTACTGGGACCTGTACGAAGGCGTGGACATTGCGCTGCCCAAAGTGCAGATCCCCAAGGA
GGAGCAGGACCCGCACAGCAAGCGGCTGCTCAAGGTGTGCGACCTGTGGGACAAGGAGTTCACACCGGAGCAGGTCAAGC
GGGCGCGGCGTGCCTACTACGGCGCTGTCAGCTATGTGGACGACTGTCTGGGCCGGCTGCTGGGCATCCTGCGTGATTGC
GATCTAGAGGACGACACGATTGTCATCTTCAGCGGCGACCACGGCGACATGTTGGGCGAGCGAGGGCTGTGGTACAAGAT
GTCGTATTTTGAGTCGTCTGTGCGCGTGCCCTTTCTCATCCACCACCCGCACGACTTTGAGCCGCACCGCGTGAGCCAGA
ACGTGTCGACGCTGGACATCCTGCCGACCATGTGTGATCTGGTTGGCGCCCGCGTGCATGTCGACCTGCCCATGGACGGC
ACGTCGCTGCTGCCGCACCTGCAGGGCCTCGCCGGCGGCCCCGACACTGTCATTGCCGAGTACACGGGCGAGGGCACTGT
GGCTCCGCTCATGATGATCCGCCGTGGTCCCTGGAAGTTTATCACCTGTCCGTCTGACGGGGTGCAGCTGTTCAACCTCG
TGGCCGACCCACTCGAGCTGCACGACCTGGCCAAGAGCCTGCACAAGAAGCGCTCCGCCAACGGTGGTGCCGTGCTCTCG
GCCGCCGATGCCGACGCACTCAAAGTGCTCGTCGCCTTCGAGACCGAGGCGGCTGCTCGCTGGGACTTTGACCGCATCAC
CGCCCAGGTCCGTCTGTCGCAGCGCCAGCGCATGTTTGTCTGGCCGGCCCTCAAGATCGGCAAGTTCACCAGCTGGGACC
ATGACCCGCACGACGACGGGCGCGAAAAGTAAGTTTCGATGGGCGGAGAAGAAGATGCGGCAAAGGAGCGGCAATGCTGA
CAGGAAACAGGTATATCCGCTCGCACATGCATCTCGACGATCTCGAGCGCATGGCCCGGTACCCTCCTGTGGACCGTTGG
GGTCGTGTAGAAGCGGCCAAGTGAGAGGCGAGCAGCGAGAAGGAAGGGCGGTCTGTACTTTGAGCGTTGCAACATTTAAT
GAGATATGCAGGACTTGCAAATAGTTCCATTCGAATCCGGAAAGGGCAATCATAGGCAAGAAGGCACATAGACTCTTTAA
TGCCATATATGCATGTATGCGGAGTACGTGTTCCTTGTAAGACGTAATGGGTATAGCGCGCTTCCTCTGACCCCACTCAT
CTATTGGCCAAATTCCCCGCCTGCGAGAAGCTGTCGGATCTCTCACTTTCGACTTGCGCCGCACCCAACATTGGTCGTTC
TCAGCGCGATTGCACGACCGCGGCTGCCCCTGACAGTATGGCACCAACAATGGCATCCGACGACACGGCCCTCGGGCTGA
CGCAGGAGGACCTGAAGGCGATTGACTCGGTGCGGGGGCGGTTGTATCAGCTGACCAATAGTATTGATCGCCTGAAAAAC
AGTGTGTTGATGAGCAATCCGATGCCGACGCCGTACGTGGGGACAGAGAGGGAGGATAGAGAGGGAAGAGGATGCTGACC
TCGTGGCAGGGAGTCGATCCAGGCGTCTGCGTTTGTGCTGCAGCAGAATCTGTCCTCGCTCAACGAGGTGATGGCCCAGC
ACGCCGAGCTCTTCCGCCGCATTGTTGTGCACCCGGACCCCATGTTTCCGGGCCGCACGGCCGAGCAGGTGTTGACGTCG
CTGCTGCGCAAGAAGCTGGAGCCAGACGTCGAGCAGATTGCCGAGACGGCGCGCGAGACGGCAGCAGCGCGCGGCATCGG
GCCCACGAGCTTTCTGGGCAGCGGCGCGGCCGGCAAGCAGGCCCGCCACGACGAGGAGGAGGAGGACGACGACGACGACG
ATGATGATGACGACGATGACGACGACGACAGCGACAACAGCGACGACGACGACGGCCACGGCAACCGCAACGGCGACCCG
CGCGAGCCGCTCGGCCTCGGCGACATCTGGGCCGACGCCCGCGCCTGGTGCATCGACCGGATCGGCGACTTTATCCGCGA
AGAGGCCTCGGACCTGTACACGAAGCGGGAGCGCGAGGTCATCGGCATCGAGAACGTCCGGACCGGCCTGCGACGGTCGC
TGGAGGAGGACGACGAGGACGACGAGGACGAAGAGGACGAGGACGACGAGGACGAGGACGACATCGCCACACGACAGGAC
CAGGACGTCGTCATGCTCGACAGCATCGGGACAGGCACATCCACGGCGCCCGAAAAGACAGAAAAGACAGAAAAGACAGA
ACTGCCCAGAGGACCACCGGTCGAGCCAGAGGTGCTGCTGTGGCTGGCTGCCCGAGGCGATGCCGAGCTGCCGCGCTACG
TGGACATCGAGTCGCGCAAGGCCGCTGCAGCCAAAGCGGCGGCTGCGCAGAGACGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62