GenePrediction:GLEAN_3356 Details

Name: GLEAN_3356
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:847901..849200 (+ strand)
Length: 1300
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:847901..847972 (+ strand)
Length: 72
Type: CDS
Source: GLEAN
Position: GCSC_89:848028..848174 (+ strand)
Length: 147
Type: CDS
Source: GLEAN
Position: GCSC_89:848244..848633 (+ strand)
Length: 390
Type: CDS
Source: GLEAN
Position: GCSC_89:848702..848757 (+ strand)
Length: 56
Type: CDS
Source: GLEAN
Position: GCSC_89:848816..848961 (+ strand)
Length: 146
Type: CDS
Source: GLEAN
Position: GCSC_89:849013..849200 (+ strand)
Length: 188
>GLEAN_3356 class=GenePrediction position=GCSC_89:847901..849200 (+ strand)
ATGATGGGCCTGCCGACGTACTTCCAGCTGAGCTCAGGACATGCCATCCCGGCCGTCGGCCTGGGCACTTGGGTAGGTCT
CTGTCCACACGCGTGTCGTCGTGTTCTCGTCTGCTCACCAGATGTAGCAATCCCGGCCGAACGAGGTCAAGAATGCGGTC
GAGACGGCTCTGCGGTTGGGCTACCGCCACATCGACGCCGCCGCCTGCTACGACAACGAGAAGGAGGTGGGCGATGGGAT
CAAGGCCGCGGGCGTCGCCCGGAAGGACATCTTTGTAAGCCGTGGTGGTGGATGCCAATCGTCTGAAACGCCTGCATCGC
TTCTGCTGACCGCCCGTCCCTAGCTGACAGGAAAGCTGTGGAACACGCACCACAAGCCAGAGGACGTCGAGCGCCACCTC
GACACGACCCTGGCCGACCTGCAGACCGACTATCTCGACCTCTACCTGGTCCACTGGCCCGTGGCCTTTGAGCCGGCCGG
TGAGGCCGTCCGCTTTCCCGTCGACCCCAAGACGGAGCAGATCGCTGTCATCGACGTGCCCATGGCCGACACCTGGAGGG
CCATGGAGGCTGCCGTGCGCAAAGGCAAGGTCCGTACCATTGGCGTGTCCAACTTTACGCGCCAGCACATCGAGGACCTC
TGGCAGACCGCCACCATCCGCCCGGCCGTCAACCAGATCGAGGCGCATCCGTATCTGCAGCAGCCTGACCTGCTAGAGTG
GTGCAGACAAAACGTATGCGCCCCTGATCAGCTGCTTTCTTGTCTTCTGTAGCCCGACTCCTGCTCACATGGCGCCTCTA
GAATATTGTCGTCGCTGCCTACAGTCCCATGGCCAACAACATCTACAACCTGCCACGGTAAGAACTTGGAGTCTGTCGGG
CACGGCGTTACGCGAGTCTAACCGCGTCCACATAGGGCCATCGATGATCCGGTCGTCATTGAGCTGGCAAAGTCCCTCGG
CAGAGAGCCGGCACAGGTGCTCCTCAGCTGGGCAGTCCAGCGAGGCACCGTTGTGCTGACTAAGTCGGTCACACCAGCAC
GCATTGCGCAGAATCTTCAGGGTCAGTGGGAAAGTTCAAGACGAAGAGAGTCTGCAGCTGACATCACCGCAGTCTCGGAG
CTGCCCAAGGACGTGTTCGACAAGTTGAACGCGCTCGACCGCCACAGCCGTTACAACTTCCCCAAGCGTCTCGGCGTCAA
TATCTTTGGCGAGTGGACCGAGGCCGCGCTCAAGGCGGCCGTCGAGGAGTGGAAGGAGGCCCAGAGGGAGCTGAAGGCGG
CAGCATCGTTGAAGGCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62