GenePrediction:GLEAN_3357 Details

Name: GLEAN_3357
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:849494..850819 (+ strand)
Length: 1326
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:849494..849669 (+ strand)
Length: 176
Type: CDS
Source: GLEAN
Position: GCSC_89:849734..849843 (+ strand)
Length: 110
Type: CDS
Source: GLEAN
Position: GCSC_89:849897..850008 (+ strand)
Length: 112
Type: CDS
Source: GLEAN
Position: GCSC_89:850066..850819 (+ strand)
Length: 754
>GLEAN_3357 class=GenePrediction position=GCSC_89:849494..850819 (+ strand)
ATGGGCAAGATTGCAACGATGGAGTGGTTCCGGGTGCCGCCCCGCTGGCTCTTTGTCAAGATCACGGACGAGGCCGGCAA
CGTTGGCTGGGGCGAGGCGTCGCTGGAGGGACACTCGCAGGCCGTCGAAGGCTGTCTGGACGCCTGGTTTGCGCGATACA
AGGGCATGGAAGCCGAGTGAGTGGATGATGGACCGGCAGCCGGACGGAGGACGCGAGGCGCGTGCTGACCTGCGACACAG
CGACATTGAGCACATCTGGCAGCTGTCCTGGCGCACCAGCTTCTACCGGGGCGGCCCGGTCTTTATGAGTGCGCTGTCGG
GCATCGACATTGCCTTGTGGGACCTGAAGGGTGAGTTGTCTGTCGTCGGCCGATCGTCTCTTGTCCGAGAAGCTGACTGG
CAGCGCGGAAACTCGGCGTGCCCATCTACCAGCTGCTGGGCGGCAAGCTGCGGACGAAGCTGCGCGTGTATGCGTGGATC
GGTGGTGACCGTCCGGGGGATGTGGTGAACCAGGCGTAAGCAAGAACCGGACAGCGTTCCCGTCACGGCGAAACACGCAC
ACCCGCTCACAGTCCCAGGATGGCACGCCGCGAGCAGGGCTTCCGGGCCGTCAAGATGAACGGCACCGAGGATCTCGGCT
GGCTGGACCGACCGGCCGCTCTGGACGACTGTGTCGAGCGGGTCAAGGCGGTGCGGGCACTCGGAATAGATGTCGGCGTC
GACTTCCACGGCCGCGTGCACAAGCCGATGGCCAAGCAGCTGGCACGGGCGCTGGAGCCGCATCGGCCGCTCTTCATCGA
GGAGCCGCTTCTGTCGGAACACGGGGCCGGGATCGAGCAGCTGGCCGGCCTCACAACGCTGCCCATTGCCCTGGGCGAGC
GGCTGCACAGCCGCTGGGACGTCAGGGCGCTGCTGCCACACATCGACGTGCTGCAGCCGGACGTGGCCCACGTCGGCGGC
ATCTCGGAGCTCCGCCGCATCGCCGCCATGGCCGAGACCTACGATGTCGCCCTGGCACCGCACTGCCCGCTCGGACCCAT
CGCGCTCGCTGCCTGTGTTCAGGTCGATGCCGCGTCGCCCAACTTTGCCATCCAGGAGATGAGCCTCGGGATCCACTACA
ACAGCCAGCTCGGCCACCAGGATCTCACCAGCTACACGACCAACCCCGAGGTCTGGACCGTCCACGACGGCTACATCCAT
CTGCTTGAAGGTCCTGGCCTCGGCATCAACATCGACGAGGATCAGGTCCGTCGCCTGGCCAAGGATACCGAGCCCTGGGT
CTCGCCAGGCTTCCTCGGGCCTGGTGGTGAGGTGAGGGAGTGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62