GenePrediction:GLEAN_3358 Details

Name: GLEAN_3358
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:857397..858290 (+ strand)
Length: 894
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:857397..857460 (+ strand)
Length: 64
Type: CDS
Source: GLEAN
Position: GCSC_89:857527..857576 (+ strand)
Length: 50
Type: CDS
Source: GLEAN
Position: GCSC_89:857700..858190 (+ strand)
Length: 491
Type: CDS
Source: GLEAN
Position: GCSC_89:858257..858290 (+ strand)
Length: 34
>GLEAN_3358 class=GenePrediction position=GCSC_89:857397..858290 (+ strand)
ATGCTCAAATGCCACTTTTCCCCATCCCCGCCTCCTCGCTTCTGTGGACATCTCCAGATCCTTTGTTAGTGGGGAGGAGG
GGCTTCAGCTTCTCTTCTTGGTATCATTAGCTGACTCTGCGTCCCTGTAGTGTCGTATGCAGAGATTGCTGCCAAGGGGC
CCAAGCAGTCGCCTGAAGAGGTATGGTACATTTTGGACGATTTTTGACAGACGCCTGCACAAAGTACCGCACAAGACCCT
CTACTTTGTCCTCACCTGTTCCACCCCGATAGAGACTTGCTGACACCCATTTTTTTCTTCCAGGCTGCCGCCCCCGCTAT
GCCTGAGATCGAGCCGTCTGAGTCGGCAGCCTCGACTGTGTCACTGATCGATGTCGATACACCTTCTATCCGGACGGTCC
CATCCGAATTTGGGGAACAGTCCGTGACGACGGAGACACAGGCAGAGCGTCTGGAGCAGGAAGCCGCCGCCGCTGCCACC
GAGGCCAAGGTCCATGCTAGCAAGGCTGCCGCTCGAGCCCGATCCAAGACCGAGGGCACGGCCAAGAGAGCCGCCTCACA
GGCACGCCGCGCAGACCGCTGGATCACGGCCCATTTTGCCGCCGTGCAGGAGGACCACCCAGTCGTTGCCCAGGCTGCTG
TCGTCGGCAACTTCGCTGCCGTTATTGGGCTCGGCGCCCTGCTAGGATTTCGTGCGTGGGGCCTTTACGACCAAGGCCGC
TTCAGCTGGAAGGCCGGTGCCGCAGGACTCGGCCTTTTCGGCGCCGTCAGCCTATTCGAAGGCTTCCTGGCGAGGTAAGT
CTTGTTGCCTTTGAAGGAGAACCCCCCATGATCTTCTGCTCTTGCTGATCTCTCTCATAGCTACTTCTACAAGGGCAAGC
CTAAGCAACATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62