GenePrediction:GLEAN_335 Details

Name: GLEAN_335
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1134493..1137266 (+ strand)
Length: 2774
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1134493..1136850 (+ strand)
Length: 2358
Type: CDS
Source: GLEAN
Position: GCSC_167:1136898..1137266 (+ strand)
Length: 369
>GLEAN_335 class=GenePrediction position=GCSC_167:1134493..1137266 (+ strand)
ATGCCTCAGGCACAGGACAACGCCCGGTTCGTTTTCATCGTGCTGCTAATCATATGGCTAAATGCGGGCAACGACAACGG
TACGGGCCTGTTATCGGCGCCGTCGCTAGTCGCCGGACGGCTGTACCGACAGCGCGCAGCCTACACGACGATGGCGAACT
CGAGCTGGGGCGACTTTGATCCGCAGCCACAGGCCGTGGCGAGGCCATCCGATGCAGCGACGGCAGCGACGACGTCTCCT
CCATCGAGCGGCCGCTACCTCAACCTGACCGGTTTTCGCGAGGAGGACGGACTGGCGTGGGACGATCTGGCTACGTTCAA
GCAGCGATGTCTGGAGTGGAGCCGGCGGGCGTTCCAGACGGCTCACGGCCACAGTCTCTGGGACGTGGCCCAGGTGGTGC
CGACATGGCAGAATGCGACGGGCACGGTTCACGGGTCGTGGGTGCGTCAGGCCTGTTCGGTGGAACGCGACGCGACGAGC
TACAACGGCTCCGTGCTGACGGGGTCTGGGACGTGGGACCACATGGACGACGAAGGCTACGAGTCGAGGCCGCTGCTGGA
GGGCTACGGCAGCCGGGCGCACGACAGGGCGAAAAGCAGCAACGGGACGACGACCAAGTCCAAGTCCAAATACGAGGACA
AGAATGTGGTGCAGTGGAGCCGCAACATCACGGGCCAGTCTGGGCGGATGGTGGTACGGATCACAGACAACGAGGAGGAC
GAGCGGTACGAGAGCGAAGACAGATCTGGTGAAACAACAACAAGCGGGCCGGGGGCGGGCGGACTGGTGCGGACGGTGAC
GGCAACAGTGAACATTGAGGACGAAGAGGGCACAGGCAGCTCGCACGACATGCGGCTGCACGGGGTGCACTGGCCGCACA
AGGGAGCGCTGATGCTGGCGACGACGAGCGAGAAGTTTGCGGGCATCTTTGGGCTGCCACACCTGGCGCCAGGTGAGGAG
TTCTTCCGATCGAGTCAACGGCTGCTGAACCGGACGCTGGACGCGGCGCTGCGACAGCGCGAGCGGGTGCATGGGTTCGG
GGCGCCTGACCCGGCGTATGCGAGCCCGCTGTGGACGTCGAGCGTGGACGAGACGCCCGAGGGTCTGTTCCCGTCGCCGC
GCTGCGAGTATGTCATGTACCTGCAGATACACCCGGTGGAGGCATCGCGGGTGTTGGGCAGTGCGAAGCAAGCAGCAGCA
GCAGCAGCAGCAGCAGCCGCCGCAGGAACCGAGCTGCAGGAGGACCAGAGCCAGGAGCAGCTGGTGGCGGCAGCGATTCG
CGACATTGAACACGAGCTGCGATTTCCGAGCGGCGCGCCGATTGCCGGAGGAGGCGGGGTGGTGCCGACGATGCAGATGT
CAGCGATGCTGTACTCGCCCGACTGCGCATACTTTATCGAGACCAAGGGCCCACCTCGGTTTGCGGCAGCCGAGGGCCAG
CACCTGCGGGGACTCAAGTCGGAGGTGTTTGTGTACGAGGCGCGGCTGTGGATGCTGGGCTATGCGGCCGTCTTGGGCGT
GCAGATCAAGCTGCTGCTGGGCCAAGTGCGCTCGACGTACACGCCGTCGACGCTGGGGAGGGCTAGCTTCTATACGGTGG
CCATGATGCTGCTGGCCGACGGCATGGTGTTTGTGTCGGCGTCGGCCTGGACGCTGACGGCGTCGGCGAGCTTCCTGCCT
TCGCTGGCGGTGACGTTTGCCGGGTTCCTGTCGGTGACCATTGGCGGTGGCTTTCTGTCGGAGATCTACACGGCACAGGA
ACCAGAGCGACGACGACAGCGGCGACGACGACAACGAGAGCGGCAAGAAAGACAGCAGCAGCAGCGACAAGTGTCTGTGC
CCATCATCGTGCCGTCAGATCAAGACGTGGATGCAGAGATTGAAGAACAGGAGGCTGCAGAGCGGCAGCAGTCGGCGTTT
CTACTACCGGCTCCAGCAACAGCCAATGCACCTGCAGCTGCTGTAGCTGCTGCAGCTACTGCACCAGACACATCCGACAC
GCCGTCGCCGTCGTTTTCGAGCGTGGCCGGACGGCTCGCTATGCTGGGACTGGGACTGCTCTTTTTGAGCCTGGCTGCGA
TGACGTGGTGGGCATCAGCACGGGCAGTGTACGCAAACGTGCTGGCAGCAGCATACCTGTCGATGTGGGTGCCGCAGATT
GTGCGCAACGTGGAGCGCAACAGCCGGCGGGCGTTTGCGTGGCCGTTTATGGTGGGCCAGTCAGCGATGCGGCTGGCGCC
GGTGGCCTACTTTTGGCTGCGAGCCGACAACGTGCTGTTTGCACGGCCAGACCGCCATGCCTTTCTTGCGCTGGCCGCCT
GGGTCTGGGTGCAGCTATGGGTGCTGGCTTTCCAGGACGTTTTTGGGGGCCTCGTTTTGGCGTGCCAATCGGCTGGGCAC
CCGAGGCTTGGGAGTACCACCCGGTGCTGCGCGAGGATGCCGTGGAGGCTGGCCGGCTGCCGATTGGACTGGTCTCTACG
GTAGATGGAGAGGATGGCAGCGGCAGCAACAATAACAACAGCACTGACAGCAACGGGCTGGCGAGCACAAACCTCTGGAC
AGTCGACTGTGCCATCTGCTGCGAGGCTCTCGACGTGCCTGTCATCCGCATGGGCGTCGAAGACCCTACGGCCGGCGGTG
TGGCCGGCGTGCTGGCCCGGCGCCAATACATGGTGACGCCGTGCCGTCATGTCTTTCATACCGCCTGTCTCGAGGGCTGG
CTGCGCTTCCGGCTGCAGTGTCCGATCTGCCGCGAGGAGCTGCCGCCGCTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62