GenePrediction:GLEAN_3360 Details

Name: GLEAN_3360
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:876437..877041 (+ strand)
Length: 605
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:876437..876448 (+ strand)
Length: 12
Type: CDS
Source: GLEAN
Position: GCSC_89:876535..876870 (+ strand)
Length: 336
Type: CDS
Source: GLEAN
Position: GCSC_89:876958..877041 (+ strand)
Length: 84
>GLEAN_3360 class=GenePrediction position=GCSC_89:876437..877041 (+ strand)
ATGTTCCGTTTTGTGAGTAAAGCGTCATGCTGCTGTTGTTGTGGACTTGGAGAGAGCCGATCCCCCAAACAAACAGCATA
AGCTGACCATTTCCACAGCCGAAAACCCTCGACATTGTGACGCTCTTCCACAAGGCGAGCTCGCCTGCGTCGATCCGCGT
GTCCACCTTGCTCAAGCAGGCGTCTGCCCACGCCTCGCAGACGGCCACAGAGGACCAGGCCAGCGACACGACCGCGCAGA
CTTCTGCACCGACTGCGGGTCGCGAGACGTTTGAGCTGGAGATCACCGAGGAGCCGCCGACGACGGACCAGCTGCGCACC
ATCCTCGACTATGTGGGTACCCCGGCCATCCCGACGGTGATGAAGGGAGCAAGCACGACGGCCGAGGCGCTCAGGAAGTT
CAGGGAGAGCGCAGACAACTTTCAGCGCCCAGTGGTAAGTTCTTTATTTGGGGGGGAAAGGACAGACAGACAGCCTCACA
TAGTCAATCAGCTGACGCTCTACCCTTTTCCTTCTGTGCAGGTTGTCGATTGGAACAACGGCAAAGCAATTGCAGGGGAA
AACGAGTCGGAGATTCTCAAGCTGTTGAACTCAACTAAGTCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62