GenePrediction:GLEAN_3361 Details

Name: GLEAN_3361
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:878825..879522 (+ strand)
Length: 698
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:878825..879183 (+ strand)
Length: 359
Type: CDS
Source: GLEAN
Position: GCSC_89:879246..879522 (+ strand)
Length: 277
>GLEAN_3361 class=GenePrediction position=GCSC_89:878825..879522 (+ strand)
ATGTCTCCGTCTGCCATGTTTGCGCGCACCGCTCTGCGGCCGCTGTCCGGCGCGTCCGCTTCGGCCTCGTCTTCCTTCTT
CCTCGCCTCTTCCGTCACCCGTCACATGGCGACGGCTCGTCCGGTCGCGGCAGCAGCAGCGCGCACAACGGCTGCCGGCG
CCAAGACAGCCCTGCCCAAGTTCTCGACGGCTTCGTTCATGGCAGCAGCGTTCCGCCGGGCGTCCAACCGCAGCGGCAGC
CACGGCGGCCGTCGCTATCAGAGCAGCACAGCCGGCGCCGATGCCGGAGCCCATAGCAACCCCAGCATCTTCAAGCGGCT
GTGGGACAGCCCGGTTGGCGTGAAGACGGTGCATTTCTGGTAGGGTCTCGGTCTATCGCTTCTCTCGCTGTCTCGCTGCT
ACGAATGCTGACATCTTGTAGGGCCCCCGTGCTCAAGTGGGTTCTCGTCCTCGCCGGCATCTCCGATCTTGCACGTCCGG
CCGAGAAGCTGTCGGTGACGCAGAACATCGCCCTGACGGCCACCGGCGTCATCTGGACGCGCTGGTGCCTGATTATCAAG
CCAAAGAACTACATGCTCGCGGCCGTCAACTTCTTCCTCGGCATCGTCGGCATCATCCAGTGCACACGCATCTTTATGCA
CAGCCAGCAGGTCAAGAAGGCAGAAGAGGCCGAGACTCCCGCAGCCGTGGAGCAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62