GenePrediction:GLEAN_3362 Details

Name: GLEAN_3362
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:892221..893262 (+ strand)
Length: 1042
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:892221..892424 (+ strand)
Length: 204
Type: CDS
Source: GLEAN
Position: GCSC_89:892800..892922 (+ strand)
Length: 123
Type: CDS
Source: GLEAN
Position: GCSC_89:893116..893262 (+ strand)
Length: 147
>GLEAN_3362 class=GenePrediction position=GCSC_89:892221..893262 (+ strand)
ATGGATGACATCGGCTCCTGCTGTGAGATACGAGTACAGAGTAGGCTGCCATCCAGGCTTGCCGGCCCAGCTGACGTGGC
CACAGTGGCCAACTACCTTCTCCACCGCCACACCGTCTTTAAGACGCTGGTTGCTCACCGGCAGTACGAGCATGTAGCCC
CCCAGATCGGCGGGCAGCTTGTCCGCAAGACGAGGCGACTTCTCGTACGTGTAGATGGAGACAGGGCCGTGCCTGAAACA
GACTGGCACCAAATGCTGGCATTGCCAGCGTAGCCGTGGGCCGCGTGACTCGTGTTCACGTCTGTGCATAAGCAGCACAA
AACGCGCCGGGCATACCCTACCTATACCCAGAACCGAGGACAGCAAACCGCGTCACTGCCGTGGGATTTGGACAAGATGC
AGGGAATGGACCAGAAAATGGACCGCGTAATGATATCCCGTAGTTTGTATCTTACTCCGTACGCCGCACTTGCCATATGG
AGTGCTGTGTTCTAGTACTCCGTATCGCCTGTCGATTGGGCCTTCCTTCAGTGAGTGTCTAGTCATGTGACCGCCAGGTG
CCTCCAGCGTCCTTGGCAGGCTGCACTAAAATCAGGAAAGAGCCCCTCAGCCCGAAGCGGTGGTGGCCCACTGAGGAAAT
TCTGGTGCACGATTGGCATGTGCGCCATGTTCCCAGGAGTCCCTGAAGCAAACCAGCCTCCGGTACGAAAACGGTGTATC
TGCAGCTATCCTGCCGCCTGGACTGCTTAATTGACAAGGTACGAACTGGTTCTGTCCCCAATGCAGGGCCCCCCTCGCGT
GGCTGACCATATTGCTGCCCGGCCTAGCTTAGAATAGACGGCCCCAAAACGAGAGACGGAAGGGAATGTGCTTGGCCTCG
TGAATGGGGTGACAGCAGGCCAGCATTCTCGCGAGCAGTCCGCAAGAGGATGAGAGGAGGCAGAGGGACAGGTGGCCGGG
CGAGTACAACAATCGCCAGCAGCAGAAGGGCAGAAGCCAGAGCTCGAGGCAGTTGGAAAACGAGATAAGCAGCACCTCGT
GA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62