GenePrediction:GLEAN_3363 Details

Name: GLEAN_3363
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:893387..904354 (+ strand)
Length: 10968
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:893387..896117 (+ strand)
Length: 2731
Type: CDS
Source: GLEAN
Position: GCSC_89:896176..897596 (+ strand)
Length: 1421
Type: CDS
Source: GLEAN
Position: GCSC_89:897662..901645 (+ strand)
Length: 3984
Type: CDS
Source: GLEAN
Position: GCSC_89:902045..902188 (+ strand)
Length: 144
Type: CDS
Source: GLEAN
Position: GCSC_89:902618..902900 (+ strand)
Length: 283
Type: CDS
Source: GLEAN
Position: GCSC_89:902954..903064 (+ strand)
Length: 111
Type: CDS
Source: GLEAN
Position: GCSC_89:903141..903865 (+ strand)
Length: 725
Type: CDS
Source: GLEAN
Position: GCSC_89:903923..904354 (+ strand)
Length: 432
>GLEAN_3363 class=GenePrediction position=GCSC_89:893387..904354 (+ strand)
ATGGCCACACGCCCGAGCCGCTACCGCTCGTCCACTTCGGCCTCCAACCCACCGACGACGACCAAGGCTGCCGAGGTGCT
CCAGGACCTTCTGAACGGCACTCTCTCGGTGATATCTACGCCGTCGTCCGGCTCCGGCGGCTACCCCGACATCCACTCCC
TCCTAAAGTATGTCCGACAGGTCCATCAGCACCTCACCGCCCTTGCCCCACCGAGCTCGGCGCAGGATGACTTCCGCCAC
CTACACGGCTTCCAGCTGCTGCTGAGCATGCTGCGGTCGTTCTCGGGGTTTTACAACCCGCAGAAGCGCAGCGACCCGGA
GAAGAAGGCCCTGTTTGAGCTGCTGCACGCGACCCTAGCTGTCTTGTCGGCGGCGTTTCGCGGCCACCAGGGCAACCGCC
GGTACTTCCACCTCCGCGTCGAGGGCGGCGGGTGGGAGGCACTGGATCAGATCATTGCGAGTATCGGGCTGGGCGTGAGC
GACTCGGACCTGTGGAGCAACTGCCAGCTTTTTGGCAAGCTGCTCGCCTTCGCCCTGGACGACCAACGGATGGACGAAGT
GGCCCAGTGGATTGCTCAGGACCGGGAAGAGGGTGTGACGGTAGATGTGGAGGAGAAAGAAGAGAAAGAGGAGGAAGAAG
AGAAAGGAGAGAAAGATGGGAAAAAGGAGACAGAGGAGGAAGAGGGACAATCGGAACATACCGAGGAGAGAGTGGAGGGA
AAGGAGCCCAAGACGAACGGGATGAACGGGAAAACTGCTCCGGATGCCCAAAGCAGCACAGTCGACATCTCGCAGTTGAA
GGCCAAGCTTGGTGTCATCATCGGGCCCAAGACGGTGCTGCAAAACGCAGAGGTGATGCGGACAGTGATCGGGTTCTGGG
AGTCGATTCCGCGGAGCCATGCCGGCGCATCGGACCCGGTGTCTCTGCTCGTTCTCGAGACGGTCGCCGCAGTGCTCTCG
ATCTCGTTCTCCAACCTGTCAGCGCTCCACGAGACCGGGATCCTCTCGCGGTTCATGCACCTCTATTTTGCGGCGGACTC
GCCGCTCAGTGCGGACGAGCGCGCACGCATCCTCCCGATCTGCCGGTCGATGATGTGTCTGGGCGTCAACCAGCTGGCAG
ATGCGCAGTTTCTCCTCTCCAGCACCGATCCGGCCGCGTCCGAGTTTTGTCTGGCGATGGCGGCCAAGTACAGCGGCCCG
CCGTTTGTGCAGTTCGACCTGTCGCGCCGCGGCTACTCGTCCATCGAGCTACCCACTCTCGGCCGCTCGTTTCCGCCAGC
CAATGCGGGTTACACCTTTACGTGCTGGCTGCGTGTCGACACGTTTGACCCGCGATCGCACACGACCATCTTCGGCGTCT
TTGACGCCACGCAGACCTGCTTCCTGCTACTCTACCTGGAACGAGACACGCGTAACTTTATCCTGCAGACGTCGGTGACG
TCGTCCCGTCCCAGCGTCCGGTTCCGGTCTGTGGGTTTCGAGGAGGGCCAGTGGTACCACGTTGCGCTGGTGCACCGCCG
GGCCAAGGCACGGGCGTCCCTGTATGTCAACGGCGAGTTCGTCGAGCAGGTCAAGTCGGCCTACCCACTGCCGCCACCAC
CAGCACCGGGCAGCGGCAGCGAGCCATTTGTCTCGTTTGGCGGCAGCAGCCGGGTGAAGCTCAATCCGGTGCAGGCGTTC
CTGGGCACGCCCAAGGACCTGTCGGTGCAGGTTGGGCCGGGGATGATCTTGTCGAAATGGTCGCTGGCGTCGGCCCACCT
GTTCGAGGACACTCTGAGCGACGACTTTCTGGCCGTACACTTCCGGCTTGGCCCTCGCTACCAGGCCAATTATCAGGACA
GCCTCGGCGGCTTCCAGACGTACACGGCATCTGCTAGGCTGGCCCTCCGAAACGAGATCAACGCGGGCAACGACGACAAC
TCGGACATTCTGCGGGCGATTCGGGACAAGGCGTCGTCGATTGTGCCCGAGTCCAAGATCTTGATGAGCACGCTGCCGCG
GTCGACGTTCCGGACAGACGGGACCTTTCTCGAGTCGCTGCTGTTCCGGTCACTGTCGCGGCCATCGGCGGCCAACCTGC
TGACGCTGACGGCGAAGAGCGGCACGGCCGTGGCGATCAACGGGGCGCTACCGTGCATCAACGACGCGCTGCTGCGGTCG
CATGGCGTGGCAGTGCTTACAGGCGACCCGGTGCTGGCGACGCCCTTTTTCTTTGACGATAACCTCTGGCGGCTGGCCGG
ATTCACACCACTGGCACTGAAGCTGGTGGAGCGTGCGACCACGGCCGAAGACCTGCTCCGGTCGGCCGAACTGGTGTTCC
TATGCACGAACAGCAGCTGGCGCAACAGCGACGCGATGGAGCGCGATAACGGCTACGCCATCCTGGGCATGCTGCTGCGT
GCCAAGCTCGGGGTCAGTCCGGTGGCAGCGGCTGGCCTGAGTTCGGACAGCTCCGGCGGCTCCGGCTGGCGGGCTCCGGC
TGTGACGGGCGACCGACGGGCGACCAGCCTGCGGCTGCTCCAACTGATCCTGTCGTTTGTGGGCTACAACCACGGGGATC
CGCTCGAGTCACTCATCATCAACCCGCTGGCGTACCGCATTCTGCTGATCGACTTCGACACGTGGCGCAAGTCGCCGGCA
CCGACACAGCAGCTGTACTACGAGCAGTTCAACACGTTTGCCGTCATGAGCAAGTTTCATCAGTTTAATAGCCGCAGGCT
GCTGAGGATGAGTACGTTGTGTTGCGGGTGGCAAAGGCGCGTCGGATGGAGCTGCAGCTAACCAAATAGGGATCACCAAG
CGACTGCTGGACGCAATGAAGGTCGAGACGGTCTCGGAGGAGATCATGCCGTACTTTATCAAGTCGTTTGAGAGTCTGAT
CCGGTGCAACTACAACGCCGAGGTGCACCGGGCCCTGGCGCTCTACATCACGTACGGACTCCACACGCCCAGTGCGGCGT
CTTTTCTGCGGGCGGCACGACCACCGACGGCGACGGGCAGGCCGCGGAGCAACACAACAGGACGAGTGCAGCGAAGCGCG
ACGCTCAGCTCGGCACGGAGCATGATGTCGTCCGAGTTCGTGGCGGCGGATGGGAATAGGCCGCTGCCGAAGCGGCGTCT
GGGGATTGAGATCCTGCAGTTGTACGAGCAGCTGCTGTGTGAGAACGGCACGGTGGCGAACATTCGCAAGTTTGCGCGCA
CGGTGACGAACAAGTGGCTGCTGTACCTCCTCTCGGCCGACGACGCGGTAGTGGTGGTGAGCGGCGGGCGGATCTTGTCG
CGGCTGCTGGTGACGCAAGGCGCCAGCTACACGTCCAAGTTCAGCAGCAAGACGGGCGGGTTCTGGATCATGGCCCATCG
GCTGCGGCCGTGGTGGCACATGCCGGCGGTCTGGATGAGCGTCTTGGGCGTGCTCTTTGGCAAGGACGTCGTGGGGATCA
GCGCGGAGGAACGGGCGTTTGACGAAGAGGCACTCGCGTCGATCTTTGGTCCGGGTGCCAAGGTGGTCTATCCGGACGCC
CTCTTTGCCGTCGTGTCGATGCTGCAGCAGGGGCTCAACGACACGCTCAAGTGCGAGGGGACACCGGACAGCGAGGCGGA
CGGCAAGCGAAAGGCAGCACCACTGGAAGCGATTATCCGGTTTCTGGGCAGCTGTCACCGGCAGTCGGCCGAGTTCCGCG
ACTTTGCTCTGTCGTCCGAGTACGTGCGGCTGCTCCTGTCGGCACTCTTCCCGTCGGTGGTGGGCATGGAGGCGCTCGCG
GCCGAGACCGAGCTGAACGCCAAGGACACGCCACTCCTGTTCGACAGCGGTGACAACAATAGCAGCCGGCCGGCGGCGGC
GTCTTCGTCAGCGATGGTGCGGTCGTCCAGCACGACATCAAGTCTCGCATCGAGCGTGCACTCCAGCATTGGCGGGTCGA
CGGTGGACTTCACGTCGGACTCGACGGTGCTCGCGTCGGTGGAGTCGTCGATGCACTCGACATCCGGGCGGCCGGCACTC
TCGCCCCTCACAGGCGGGACGACATCGCTGAACCGGCGGTCGTCGTCATTCATCCTGCTGACGACACAGGCAGCGCCCCC
ATCATGGCACGTGGCACGACTGGCAGCACACGCATCACCGCGACGGCGGCTGGCGGTGCCGTCGCAGGCCAGCCGGAACA
GCGTGCAGCAGGGGCTCCTGGGGCTGATCGTGGACGTGTTCGTCGACCAGGTCGTTGCGCGCAAGGAGTTTTTCCGGGGT
TTGGACTGGCTGCACGGATCCCGCCGTCATTCCAGGAGCACCAGACCTTCTTCGAGTCGTACGTGCTGCGGGCGACGACA
CAACAGCTGGAACAGAAGCTGCGAGAAGACATGGACGTGGTGTGCGAGCCCAAGGTGCTGACGAACATGGGGCGGTTCGC
AGTCAACATGGTGGAAGCGGTGCTGGACGGGACGTTTGTGGACGGGGTCGACGTGCTGCTGGACTTTACGGGGCGACTGC
TGGAGCATCTGCACCGGCCGGACGTGGCGGCACTCAAGAGCGTGCGGCTATGCAGCCAGGCGGTGACGACGATCCGGACG
TCCTTTCTCAAGCTGGTCCTGTTCCGGCTCTCAGACGTGGGCGAGGGAGATGGCGAGGACGAGAACGAGAAGGAAAACGA
GGGCGAAGGCCAAGGGAACGGCGACCTGGACGGGCTGCCGGTGCTGGAGCGGATCTTCTACTGGCAATCGGTGTTTGTGG
ACTGCCTATCGATGGAGTCAGCAGCGGAAGAGTACTACCTGAAGCTGGTGCTGTACCAGCTGTACGCGCGGCTGCTGGAC
GCCGATGAGACGGCACGACTGGCAGCAGCGAGCCTGTGGCGGGCTGGTGCTGATCCAGAAGCCGACAGAGTCAGCGACAG
TGCTGCGACAGTGCGCGACAGCGGATCAGCCTGCCACCTGGCGCGGTCGTTCCGGCACCTGACGGAGGTGGACGATGGGG
CCTTTCTGGAGTGGGTGGACCAGCACCGGCCGTCGCTGGACGCCTTCTTCCTCGGCGGCATGTCGCGGTTCTGGGAGGAC
TTTGTGGCGTTGGAGAACGGGCGGGCGGCCGAGGGATCACGACAGCGAGCAAGCCGTCGACGCGACCGACTCAAACAGTG
GCACACGGAATCGCTGGAGCGCGGCAACGTGCTGCTGCGGCACGAGATGGCCAACAGCGCGTGGATGAAGAGCATCTATG
GGACAGAGCACGCCAAGCTGCAGCGGCTGCTGCAGGACCAGCAGGACGACCTAGCCTACCTGGCAGCGACGTTTGGCAAG
ATGGAGCGCGATCTGCGGCGGCCGGGCGCGGTGTTCGCCGAGGCCGGGGCACCGATCAAGTGGAAGCTGGACCGGACAGA
GGGCCGCAACCGGATGCGATTGCGGCTGCTGCCCGACTCATCGGCACGGACCAAGGAGGAGCTGCAGTCGCGGAAGAAGG
CGTTGGACGTGGCAGCCGGAGGCGGTCTGGCAGCACGGCCATCGTCCGCGAATCCGTCAGGGAGTCCGTCAGGGCTGTCG
CCGGTGGTAGGAAGTGGACGGACGGCACGACCACCATCAGCATCGATTGGGGGGTTGGTAGGAGGAGGAGAACGAGGGGA
ACGAAGAGAAGCGGAAGAAGGAGAAGCAGGAGAAGCAGGAGAAGCAGGAGAAGCAGGAGAAGCAACAAAGCCAGACATGG
GGGTGGCGACGGCCGAGGACGACTTTGAGCTGATCGATGACCCAAACGAGCCGGAGGCAGATGACGGATTCGAGGACAAG
AACCGCAAGGTGATGCGCCGGCTAGAGCCAGGTGACGTGGTGCTGAGCGTGAGCAACGTGTCGCGGATCATCGGACTGGA
CGCGTGCGAAGGCATCCTGATCGTGGGCAAGGAGGCGCTGTACCTGATGGACAACGTCTTCCAGTGCCGGGACGGAGAGA
TTGTGAACGCGTGGCAGGCGCCGGCAGATGAACGAGACCCGTTCTCGCAGATCATCACGACCAAACCAACAGGCAACAGC
GGGGACGAAGGCGGCGCCAACAGCCGACAGCAGACACAGACGCAAAAGGCCAGCAGCCTAGAGCAGGAGTCGCGCAGCTG
GCGATGGAACGACGTGATCAGCGTGTCGAAGCGGCGATTTCTCTTCCGGGACGTGGCGATCGAGGTGTTCTTCCGCGACG
GGCGCAGCTACCTGCTGACGATGATCGACAATGGCAAGCGGGACGAGGTGTTTGGGCGGCTGACGGGCAAGATCCCACAC
GCGACAGGACCGACGAGCGCGCTGACAAACCCGGACGACGCATGGCGACTGGAAGCACTGCGAGTCGTCGACGAGGGGCC
ACAGACGCTGGGCAGCAAGTTTGGCAGCATCTTCAACACGTCGCCGTGGAACCCGGCGATGCGACGGTGGCAGCGCGGCG
AGATGTCCAACTTCCACTACCTGATGCTTGTCAACACGATGGCCGGACGGACCTTTAACGACCTGACGCAATACCCGGTC
TTCCCATGGGTGCTGGCCGACTACACGAGCGAGACGTTGGACCTGGAAGATCCGGCGACGTTCCGGGACCTCTCGAAGCC
GATGGGGGCGCAGACGGCGCAGCGACAGGCAGACTTTGCGATGCGATACCAGACGCTGGCCGAGATGGGCCAGCCGCCAT
TCCACTACGGCACACACTACTCGTCGGCCATGGTGGTGTCGTCGTATCTGATCCGACTGCCGCCGTTTGTCGACTCGTTT
CTGCTGCTGCAGGGCGGCCACTTTGACCATGCGGACCGGCTGTTCAGCTCGGTGGCGGCGGCATGGCGGTCAGCATCACA
CGACAACGGCTCGGACGTGCGCGAGCTGATTCCCGAGTTCTTCTGTCTGCCCGAGTTTCTCGTCAACGTCAACGGCTACG
ACTTTGGGCGGCGACAAGACGGCAGCACGCTCAGTCACGTGGAGCTGCCACCATGGGCCAAAGGCGACGCTAGCGTATTT
ATAGCGCGGCACCGCGAGGCGCTGGAAAGCCCGTTTGTGTCGCGCCATCTGCACCGATGGATCGACCTGGTGTTTGGCTG
CAAGCAGCGCGGCGACGCAGCGGTTGAGGCGCTCAACGTCTTCCACCACCTGTCATACCACGGAGCCATCGACCTGGACA
ACATCAAGGACCCGCAGGAGCGCGCGGTGGTGACGGGCATCATCCACAACTTTGGGCAGACGCCGCGACAGGTGTTTTCG
CGGGCGCATCCGTCACGTGACCCGGCCATAAGTCCGGCACGGCGACTAGACGTCGGGTCCGTGGCCGCGCTGACCCGGCT
GCCGCACGCGATACTGGAGAGCCACGAGCGGGTGGCGTCGTTGACATACGTGCCGCGGTTGGACCGGCTGCTGTGCGCGT
CGCCGTTCCGGCTGAACCTGCCGCCCTTTTACGACAAGTACCTGGAATGGGGCTATGCGGACAACAGCATCCGGTTCTAC
TTTAGCGACAGCCGGCGGCTGGCGGGCCTGTGCGAGAACCTGCACACGGGGCAGATCTCGTGCGTGGCGTTTGCGGACTC
GAAGACGCTGATCACGGCGGGCGAGGATTGCGCGGTGTCGGTATACGCGGTCGAGCAGGGTGGCAGTGGAGGAGGGAGTG
GGACGGGAAGTGGAGGAGGAGGAGGTGGAGGAAGTGGCAGCGGCAACAACAGCAGCGACAAGTCGGTGGAGCTGTTGACG
CGCAGCTCTCTCTTCGGCCACAAGACGCCGGTGACGACAGTGGCGACGTCGAGCGCGTTCAGCACGCTGCTGACGGTCAG
CCAAGACGGCGTGGCGATGCTGTGGGACCTGAACCGGCTGGAATTTGTGCGCAAGCTGCCGGGCGTGCGGCCGGTTGAGT
GTGCACGCATCAGCGACGTGACAGGCGAGATCCTGCTGTGCTCGGGGCCGAACGTGGTGCTGTACTCGCTGAATGGGGAT
CTGCTGCTGGACCAGAACGTGTGTGGACGGACGGGCGAGACGGGCGCCGACATGGACAGCGATGCGGACGAGGGGGATTA
CGTCCACTCGTGTGCGTTCTACGAGGGTGCGGCCTGTGAGTGGCTGGCCGACTGCCTCGTCTTTACGGGCCACCGGCGCG
GACGCGTCAGCGTCTGGCGCAAGGCCGTCGGTCCGCACGGTCGCTGGCTGCTCGAGCTGGTGCGCCACCTCGATCACGTG
GACGTCCGATCTGAGGCGGGCGCCAACGTGGACGCGGCCATCACGTGCATTGCGCCAATGCCCCAGCTGGTGTACACGGG
CGACGACGGCGGACGAGTGGTGAGTTGGGCTCAAGGGTGTTGGGTGCAGAGTGCAGAGTGCAGAGTGCTAACGGCGAACC
TTGTAGTACGAATGGAGCTTGGTCCAAAGGGACAGATGAGGGGGGATGAAGGCTGGGACCGAGAAGATCCAAGGACAGAA
GACGACCCTGAAGAGAAGGACCTGAAGATAGGCGACACGGGAGAGCGCATGAAAAATAGCCGGCGTCAGATAATTTGGTT
TGGTCATCTTGTCCTGCATGCTCTGCGCCACCGTCTATGTACACGTGCCGGTCCGTTGGTCCTCTGGCCGGAGCATGTCC
ATCACTCCGTCTCGTCGTCGTAGCCGGTCAACTGTTGCCGCGGTGTCGTTCGGGAACTGACGGTTAGCTGAGCTTGTTTC
TGCCATCCGGACAAGCAGGACTGGTCATTGAGTCTGCCGACTACACCTACTCGGATACGTCATCGGGACGGGTGCCGGGT
TCTCGTCGCCGACCAGCCGGCGCAGCGGCGGCGCCACGACAAACGTGGCCGGGCAGAGGGCGGCGATGGCGACGGACCAG
AAGTACGCCGGCCGTTCGCGGGCAGCCCAGCGGCTGTAGCGGAGGGGGGCGGCCCAGAAGCGGGGGGCGGCGGACATGGT
GGGAGGTGTTGGCGGTGGTGATGTCGACGGCTGGAATGGTGGGATCGTGATCGTAGCGGGTGCCCGTGGTGGTGACCGTG
GTGGTGACCGTAAAGCAAGAGGATCATAGGATGGAAGCAAGAATCGACTCGTGGTCATCGTGCATCCTGAATGGGTCGAA
GCTGATTCGCCCGGCACGGAAGAACAAGGCGCCGACCACACACGCTGCCGCCCCGCTTTTTGCCTCTTCGGGCAGCCCTG
CCAGACTACCAGCTGTGGCCTACGTATCCCGATCGAGAGGTTGCCTGTGCAGCGACAAGGCAGTTCCGGTCTGGACCATC
GTTCTGGACATTGTTCTCTGGCTTTCTGCAGCGATTGACGGCCTCTGCAAGCGCACCGATTGTGCTCTCTCCCCGACCTC
TTTGCTCCGCCTCTGTGCTCCGCCTCTGTGCTCCGACCTCTGCACTGCTCTGCAACAGCGGCATCCGGCCTCACCACCTC
ACTATGCCGTCGCTCCGGTCCTGTCTGTCGCTGCTCGCGCTGGCCGCCGTGTCGGCCGTGCAGGCCGTCAGCTCCAGCGG
ACCACGGCTGCTGGCCATCTTGGACGACGTCGCCGACCGGTCGGCATACTCCCACTTTCTCGGCGACCTCGAAAGTGAGC
TCTGCTTCTGCTGTTTTGCTTCTGCTCGACTTTATGCTAACCGACAGGCCGTGGCTTCTCCATCGCATACGAGACGCCCA
AGAGCGAATCGGTCGGGCTCTTCCGTCTGGGCGAGCGAGCCTACGACCATGTCATCCTGTTTCCGACCAAAGCCAAGGGT
AAGCATCCCGACGGATTTCTGGCCACGCACGCTCTACCCTCCCACTTCCTCCCCACGTCCACTCACTCTCTCAGGTCTCG
GCCCCCACCTCACGCCCCAGCTGCTTGTCCGCTTCCTCAATGCCGAGGGCAACATCCTCGTCGCCCTCGCTAGCGGCCAG
CCCGCCTCCACCTCGGTCGTCTCTCTCCTGAGCGAGCTCGACATCGCCCTGCCGACCGAGCGGACAGGCCTCGTGGTCGA
CCACTTTGCCTACGACGGCCGCGCGGCTGCAGACCTGCACGATGTGCTGCTGCTGCCGGTGCCGTCGGCCCGTCCGGGCG
TGCGGTCGCTCTTTGCCGACGCAGCCGACGCAGAAGACGGCCTGATCGCCTTTCCCCATGGCGTCGGCCACGTCCTCGGC
GACAGCCCTCTGCTGGCCCCCGTGCTCTCGGCTCCTCGCACTGCCTACAGCTACAGCCCCCGGGAACAGGCCGAGACCCT
CGACGGCGCTGACGACCTCTTCGCGGCCGGCGGCCAGCTCAAGCTCGTCTCCGTCCTGCAGGCCCGCAACTCGGCCCGCC
TCGCCCTCGTCGGCGCTGCCGAGATGCTGTCGGACGCCTGGTTCGATGCTACTGTCGCACCCACCGGCTCCGACGCCCAG
CCCCGCTCCACGTACAACCGCGAGTTTGCCCGTCGCCTCAGCGGCTGGACCTTTCAGGAAACCGCCGTCCTGCGCGTCAA
CTGGATCGAGCACGCACTCGCCGAGCAGACTGCTACCAACGAGACCAACCCAGCCCTCTATCGGGTCAAGAACGAAGTGG
TGAGTCTGTCTGCTCTTCTGCTCTTCTCTCTTCTCTCTTCTCTTTCTGACCTCCAGAACTACGCTGTCTCCCTCTCCGAG
TACCTCTGGGACAAGTGGGTGCCGTTTGTGCCGCCGGCCGGCGACGAGGTCCAGCTCGAATTCTCCATGCTGTCGCCCTT
CCACCGGCTCGGGCTCAAGCCGGCGCCGGCACTGTCGACCGCCACCGCTGCCGCCTATAGCGTCTCGTTCACGTTGCCGG
ACCAGCATGGCATCTTCAACTTTGTCATCGACTACAGACGGCCGTTCCTCACGTACCTCGGCGAGAAGATCACTGTGTCG
GTCCGCCATATGGCCCACGACGAGTGGCCGCGCTCCTTTGTCATCTCGGGCGCCTGGCCGTGGATCGCCGGCATTGCTGC
CACCATCACTGGCTGGCTTGGCTTCTGCGCCCTGTGGATGTACTCGGCACCAGTCCGGCCGACGCCGCCGGGCAAGAAGA
ACCAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62