GenePrediction:GLEAN_3364 Details

Name: GLEAN_3364
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:905708..908517 (+ strand)
Length: 2810
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:905708..905718 (+ strand)
Length: 11
Type: CDS
Source: GLEAN
Position: GCSC_89:905772..907674 (+ strand)
Length: 1903
Type: CDS
Source: GLEAN
Position: GCSC_89:907934..908068 (+ strand)
Length: 135
Type: CDS
Source: GLEAN
Position: GCSC_89:908134..908517 (+ strand)
Length: 384
>GLEAN_3364 class=GenePrediction position=GCSC_89:905708..908517 (+ strand)
ATGACCGGGCAGTAAGGCCTGCAAGACAGAGGAAAAAAAGAAAGGGGGACAACCGAACGCACAGCTCAGAGGCGTCTGCT
CTCGACGCCTCGTCCGCCAAGCTGTTGCCCCTGCTACGCTCCCGACCGCCGGCATGGCCGGTGTCTGGGCCGTGCGGCTG
CTGCTGTGCCCATCGTCGTGGCCTGTCGATATGGCCTCTCGCCGGCCAGCGAGCTTCGGCTCGCCAGACCAGCTCGCCCT
GGTCCCGGACAGGTCGCCAGCAGACAGTGCGGACGACGACGACGTCGGCAGAGTCCCTCTCGGCGCAGCAGCCGCCGTCA
CTGCCGCCATTGTCCCCACCTGTCGACTATCATTTTCCCTTTGGCAATCCCTCGCTGCTCATAGCCACGCTGCCGAGCCG
GCAACACGCAGCCTATGAGAGCACAGCCAGCTCTTCCTCGGCCGGAGTCGTTCTTTCTCCGCGTCCATCACTCTCCACTC
TGCGTCCAACGAGAGAGCGGTCCCGACAGTCCCGCGAAAGTCGCCGTCTGCGAAAAGCAGAGACGCTGCCACTAGCACAC
AGACACCACCCCCCACGGCAGACGGAACAGCAGCCGGACGGCCGGCCTGATGCGGTGTCGCCGACACCAACGGCTACAAC
AACGGCCGAAACAGCCACAGACGGAGACGCCCCGCCTGCAACGACAGCAACCGAGCAGCCGCGGTGGTCGGAGCCGGTGT
ACGTGCTGGGCAGCGATCCGCGGGCGACGTATCTGGCTCACATGTTGTCGGGCTTGCCACATAGCCCGCCGGTACGACTG
CTGCTGTCGGGCCGGGCGATGACGAACTGGCTCGAAGAGGGCCGGCGGGTACGGCTGGTACGAGCAGGCGTTGTGCAGCC
GCGAGCCCGCGTGGTGGCCGAGCTGCTCGAGCAGCCGACAGATGCGGCACTGCTGGCGGCAGCAGCAGCAGCAGACGCGC
CACCCAACACGCAGCGCCGGGTCAGGTCGCGGCACCGGCACATCGAGAACCTGGTGGTGACGCTGCCGTGCGCGCGCAGC
ATCAGCGCGATCCGCTGGCTGCGGCACCGCATCGACCATCGCACGACCATCTGCCTGCTGCAGTCGGGCCTGGGCGTGGC
CGAGCGGCTCAATGAGCTGTTCTTCGCCGACGAGGCATCCCGACCGCGTTACGTCCTCGGCTACATGACGCACGACCTCG
GCTACGGCAACCATGACCGCAACTTTTCGCTGACAGAGCTGGTGCCCGGAATCCTGCGTCTGACGGCCTACTATCCGGAC
ACAGGAGCACACAAGACGGGTGGTGCAGACGTGTCTGGCGGCGAGCTGCAGCTGGTGCGGCTGCTGGGCCTGACGCCGAC
ACTGGGCGCAGGCGGCTACGAGGTGGACGAGTTTCTGCGGTGGAAACTGCCGGAGATGGTGTCCACGGCAGCTGTAGAGC
CGATCGCGACCGTGCTGGACCTGGCGCCCAATCTGGTGTGGCGGAACGGCGAGGCGCGGGCGCTGGTCGAGGGCCTGATA
CACGAGATGGTGGCTGTGGTGGCGCGGCTGCCCGAGACGCAAGGGTCAGCGATGCTGGCCGAGTTTGTGCAGAGCGGCAT
GCTGGCACGACAGGCCCAACAGGGACGGCAAAAGGGGCCACCACCAGCACACGAAGACGTCGACGGCCTGGCGGCCCAGC
ACCGAGAGACGAGGCTGCGGTCAGTGCGCGCGACGACGCAGCAGTCGACCGTCGAGTGCCGGATGGCGAAGCTGGTGCGT
GAAGGCCGCGTGACGGACATTCACTTTCTCAACGGCTGGTTTGTGCGGCGTGGCCGCGAAGTCGGCGTGAGCTGTCCGCT
GAACGAGATGGTCATGCGGCTGGTGCGGGCGAAGCAGATGACGGGCCGTGCGCAGATGGACAGCTACGTCCCGCTGGTGA
CGGAAGACGCGGCCGCAGCAGAACAGCCTGCGTCTCCACGACAGCCGGTAAGCACAGATTGGTCGAATCCGCAAAGGCAG
AGGAGGACGACAACAGCACCGCAATGGACCGGCGACGAGGACTCTGGAGAGGCTGAGGACAGATGGACAGGACCGGGTGA
AACGATGGAGCCCATGGGCGGGTACTATTATTAAAGCGCGGAAACGACGGTGTCTGGTTTAGAGACTTTATAGACGTTTC
TGGGAGCGCTGCAATGGACTTGTGTATGTATCAAGAGAACCTGTATGAATGACATTGGTGAGTCAGCTGATGGCGCTAAA
AAAAATCCGCTGGAATTCTGCCGGTAATTCTACCCCGCTGTCACGGACGCTCCACGACGACGTGTCTGCACAGCAACGAC
GGTCAGCGACGAGCAGAATGGAAGACGACGAACTGAAGCGGGTGAGTGGATGGCGAGGGAGTTGTATTGCATTGCAAGGA
CAGGTACTGACACGTTTCCCGACCAGATCCGTGAAGAGCGTCTCCGGCAGCTCAAGCAGCAGGGCGCCGGCGGAGGATCG
GATCAGCAACAACAGCAACAACAGCAGCAGCAGCAGCAGCAGCGCCAAGAAGCTCGCAAGGACATGTTGAACCAGATTCT
CGAGCCCGAAGCTGCCGACCGGCTGGCGCGCATCCGGCTGGTCCGGGAAGAGCGCGCGACCGCCGTCGAGGACCGCCTGC
TAGGACTCGCCCAGTCCGGTCAGCTGCGCGCAAAAGTGTCCGAGGCCCAGCTCAAGGACCTGCTGCAGCGCCTGTCGGAC
GCCGAGGACGCCAAGCACGGCTCCGGCAGCATCGTCGTCGAACGGCGGCCCAAGGGCTACCTCGACGACGACGACGACCT
GGACTTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62