GenePrediction:GLEAN_3378 Details

Name: GLEAN_3378
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:1006728..1008806 (+ strand)
Length: 2079
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:1006728..1006801 (+ strand)
Length: 74
Type: CDS
Source: GLEAN
Position: GCSC_89:1006907..1008165 (+ strand)
Length: 1259
Type: CDS
Source: GLEAN
Position: GCSC_89:1008382..1008806 (+ strand)
Length: 425
>GLEAN_3378 class=GenePrediction position=GCSC_89:1006728..1008806 (+ strand)
ATGGAGTCGATTTCTGACACTATCTGGGACGTCGTTATATGTGGCACGGGTCTCCAGCAGTCTCTACTGGCGCTGTATGT
CTTCCTATCACATACCCTTTTTCCTGGCCGATTTGTCCTGTTTTTGTCTGACTGACCTAGCCATCGTACCGTGACGTGAC
TGATCTGTGTCAATCCAAGGGCTCTTTCTCGTTCTGACAAGAAAATCCTGCACATTGATCCGAATGAATACTATGGTGGC
GCCGAAGCATCCTTGAGCCTGCAGGAGGCAGACGCGTGGGCCAGCCGGTATGGTGGCCTCGAGCCATCGACATCTGCAGT
GCCTGTCTTCTCGAATGTCTCTGTGTCTCGGCTGGAGAGCCATGAAGACGGAGCGGTGTTGGCGAGCAGCAATCCCAAGC
TCGCAGCATCCCGCTCCTATGCTCTAGCTCTAGCGCCACAGCTCCTGCATAGCCGGTCGGCCTTGGTGAATCGGCTCGTA
TCCTCGCAGGCCTATCGGCAACTGGAGTTCCTCGCCGTCTCTTCCTTTTTTGTCGTCGAAGAGACGGCCGGCTCTTCCTC
TCCTGTCCCCTCGCTAGTCCGCATACCTGCAACGCGCGAGGATGTTTTTGCCACCACGGCCTTGGGCCCACGGGAAAAGC
GCAAGCTGATGAAGTTTCTCAAGTTTGTCATCGCCCATGGCAGCGACGAGGATGCAGTTTCTTCTCTGCCAGGCGAAAGC
AGCAGCAGCAAGAACACTGCAGAGTGGCAGTCGCAGGCGACAGCACCGTTTGGCGGCTTTCTGCAGAGCGAATTTGATCT
TGATGGCCGCATCCGTGACTATGTCCTGGCGTTGACACTCTCGCTCGACGGCGCCGACACTACGGTAGCGGACGGTATCT
TCCGCCTTCACCGGCACATCACGTCTATGGGTGCGTTCGGTCCAGGTTTCGCGGCTGTCTACCCCAAGTGGGGTGGCTGT
AGTGAGATATCCCAGGTTTCTTGTCGTGCCGGAGCAGTAGGAGGTGCCGTCTACATGCTTGGTGCTGGCATTCGAAACTT
GACACAGGTGGCAGCAGAGGCCGAAGACCCGGAGAAGCAGGACAAGCTTGTCGATTTGGAGCTGACAAACGACATTCACG
TCAAGGCCAGACTTATCATCGGTGGCGATGAGGAGTTGGGGACAACTCCTGCCCTGGTTTTGTCGCCGGGCTCGTCAGAG
GGCCTGCGGCCTTCTGCATCCAAAGCGGGCACGCAGCGACTCAGCCGGTTGGTGGCTGTCATCGGCGCTTCGCTTCCGTT
CCTGTTCACTCCGCCAGTCGAAGGCGCACCCGTGGCTGGCGGCGCCGTGGTGGCTATTCCGGCTGGACGGCCAGTTCTTG
CTGAAGGTTTGGCACCGGAACATCCTGTATTTGCCATGGCGCACTCGAGTGACACGGGGGAATGCCCCCTGGGACAATGT
AAGTCATGTTCATTTGCCCCTTTTTGTCATTTTCTTCACCATTTCCGCATAGAGCAAATGATGATCTTCATAAAAATACT
TATCTACATTGTCTGAGCTATATGCTTTGACGACAACACATGTTTCTGATCTGCTCTTCTCCTCTTCCACGTCTCCACCT
ACCCCCCCGCTGTCATTGCTTGTGGATTTATGGCTAATACGAGGTTCTTATCAGGCGTGTTGTACCTGGCAACAGTCCAC
ACGGACAATGCCAAGGCCGTACTCAACAGCGCACTGGACACTTTGCTAGCGGCCTTTGCAAAAAGAAATGACGAAGCTAG
CCCAGCTGTGCCACCGCAGCAGCTGCCGTGTCTATACAAGCTGTATTACGAGCAGCTTAGTTGTGGTGGCGCGCCGAGTA
GTCAGCCGGCGGCAGATTCAGCCAGCAGCTCTCGCCAGCAGCAAGAATCCGTATTGTGCTTCACGCCACTGCCGGCCGAC
TTGACAGTCCCAGACGGATCATTGGATGCTGTACGCGGAGCATGGATGCGTGTTATGGGCCACAAAGGCGTTGGCGAAGA
AGCGGGTGTCAAAAGTGACGGATATATGGTGTTTACGGACCGAGAAGGAGGCGATATGGACGATGATGCGTATGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62