GenePrediction:GLEAN_337 Details

Name: GLEAN_337
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1142777..1144609 (+ strand)
Length: 1833
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1142777..1143874 (+ strand)
Length: 1098
Type: CDS
Source: GLEAN
Position: GCSC_167:1143998..1144609 (+ strand)
Length: 612
>GLEAN_337 class=GenePrediction position=GCSC_167:1142777..1144609 (+ strand)
ATGTATTTCAACCTGTTTCGCCAGCACACTGCCAGCGAGCTCTCCGGCTTTTTCGATGACGTGTTCTGGTCGCGGACTGT
GTTGATCGAGTGCCACCAAGCTGACGCTATCCGCCATGCCGTCGTCGCCCTCGGCGCCCTCTACAAGACGCTCGAGACGA
CGACAGAGTCGCCGCCCAGCTCGCCCGACGCCGCGGGTGTCACTCCGTCCAACGCTGCCGACCGTGCTGCCAACCACTGG
GAGGTCGCCCTTGATCAGTACTCGTCTGCATGCCACGCCGTGGGAACCGTGGATCCCGCGAACCCACGCAGTCAACGCAC
ATGTCTGATTGCCAGCGTGTTGTTGGCCTGCTTCGACTCCTTCATAGGCGACCACCAGCAGGCCATCCGGCAGATCCAGA
CCGGCCTGAAGCAGCTGTGGCTACTGCGCGACAGCCGCAACAGCCAGACGGTGCTGCAAGTGGCGCCCGACGGCAGCTAT
GTCTCGCAGCCGGCCGTTCCCGAGCCGGTCGAGGATGAGCTCCTGCAGATGTTTACGCGACTCGCCATCCAGGCCAAGTC
CTACGACATGGCCTTTCACTTCCCGAAGCCCTATGTGATCTATCTGCTGCCGTCGACTGAGGCTGGTTTTTCTGAGCTGT
CGTCGTCTGATACGTCCGGGTCGTCGCCCTCGTCGCCGGCCGGATCGTCCGATGTCGACTCTCCCGTCACGGTGCACCAG
GATCCGATTCCGGTGCGTTTTTCCTCGCTGCGTGACGCACGCCTGGCCTGGGACACGTTGTGCGAAGACATGCTGCGCTT
CACAGAGAAGATGTTCCAGTCCGCCAGCGGGCCGCCCAACATCTTGCCCAGCTCGATGAGACGCTACGGCATACACTTCC
AGGCACGCCTCACCGGCTGGTCCGCGGCTTTTGGGCCGCTGCTGAACAGTCGCACACGGCCAGACGTCAGCAGCCAGGAG
AAGGCTGGCATCGCTGTGCTCAAGATGTTCCAGATCATGGGCCAGATCCTCTTCTTCATGACCTTTGTCGACAGCGAGAT
GCAATTCGACAACTTCCAGCCGCACTTCGCCGAGATTGTGAGCCTGGCATTCGAGGTGGTGGGCGACGAGGAGCAGCGAG
CTGCAGCTGCTCGCTGTCCAGACCCGAAACTTTGTGCGCACCAACAACGGCAGCAGCAGCAGCAGCAGCAGTACCAACAA
TACCACCCTTACCATCAGCAGTATGGAGTGCCCAGTTTCGGACCAAGTCACATCAAGGCCAGCTTCAGCGCCGATCTCGG
CATCGTGCCGCCGTTGTATGTGGTGGCGACCAAGTCACGTGACCGGATGCTCCGGCGGCAGGCGATTCAGCTACTGCGCA
GCAGCGCCCGGCGCGAGGGCATGTGGGACAGCGAGCTGATGGCGCGGATCGGCACGTGGGTGATGGAGATTGAGGAACAA
GGTGATGGCGAGGAAGACAAATTGCGCAGCTGGCAGAACAGCGCCGGGATGCCGTTGACGCCCGTCGACAGCCCGGCGCC
GTCGACAGTGACTCTGCCGCACCGCCAACGATCTCCCGGCGTCGACTTTGGCGATGCGCCGCTGGGTCCGGGTGGCAATG
CACGATGGGATGTGCGGCGTGAGAGCTCGACGTCGAGCGTGCGATCGTCGGCGAGTGCGACCAGTGGCAGCCTGCCGCCG
GCGCCGCCGCCGATTCCGGCGGAGAAGCGAGTGCTCGTCAAGTCGTGCGAGTTTGACCTGCGAGGACACGTAGCCACGCT
CAAGTGCGGCACGCGTGGACTTGTGGCCGGCAAAGTCGACCACAAGACACAGGTGACGCGGATTACGTGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62