GenePrediction:GLEAN_3380 Details

Name: GLEAN_3380
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:1017722..1019149 (+ strand)
Length: 1428
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:1017722..1017749 (+ strand)
Length: 28
Type: CDS
Source: GLEAN
Position: GCSC_89:1018361..1018364 (+ strand)
Length: 4
Type: CDS
Source: GLEAN
Position: GCSC_89:1018502..1018649 (+ strand)
Length: 148
Type: CDS
Source: GLEAN
Position: GCSC_89:1018832..1019149 (+ strand)
Length: 318
>GLEAN_3380 class=GenePrediction position=GCSC_89:1017722..1019149 (+ strand)
ATGAGTGGTCACGAAGTGGGTAACGGAGGTTCGTCGTTGAGTTTATGGATTCGGGCTTCCTTCTGCTTCGAACGAAAGAA
CTTTGCGAGGCGAAAATGAAATGGGCATGCCGTAGGGTTTGCAATTGACCGCGCTAAACTGGTTTTGGCCATGCTGTCTA
CCTTCTGGCGCGGTACCTTGGAGGAGGGGTAATCGGTACTTTCAATACTACAGCAATGGTGCAGTGCACGATGTAGCTTT
TTCCCACGTGATATGGATCGCGAATCCGTGTCAGTGACACTTGGAAGGCTTTTACGAGAGGACAGACTGATCCATTGAGA
AGCGTTGACAAAAAATGCGACCAGGTGTAAGAAGCGGAATAACGCATTCATCACCTCACAGACTTGCCACCACGTATACC
AGCCTGTTCCTCTACAAAGGGAGCAGCAAGGGCGATGGCAATGCGATTGACGTTGCTGCGGACCGCAACAACGATTATCC
GTGTGGACAGAATTTCCCGTGTGGTCGTCTTAGGGCAGGCGACGAATTTTTCTTAGGCGCACCAAATTATCCATTCCGCG
AAAGAAAGAAGATATCCCGACGCTTGGTTTGCATCTCGAATTTCCATCTTCAACCTAACCATCCGCACAACGTGAGAAGT
AAGGTGAGTCCATCCATTCTGGCAGCGGGCTATAACATACCCGATCACAACGGTGGACAAACCCCCCGTCCTGCAATCAA
GTACTGTGGCGACTGACAGCATATATCGCCTCGGTCACAGCCAGCCTCCTCTTCTTCCAGAACCCGGACAATTATCACAA
TGGGCGACGCAACAGTTGTCGGTGCAAAGTGGCGGCTCGTTGAGCTGGGCCGCGTCGTCCTTCTGCAGGGCAACGGCCCG
TACGCTGGCCGTCTGGCCACGATCGTCGAGATCATCGACCACAAGCGGGTGGGTACCTATCCTTGGGGGAGCTGAGAGAG
GGAGGGGGGAAAAGGCGGAGCTGAAAGAGGAGACGATGCGAAGCAGGGAGGGAGGCGACAGAGCGGCGACGCGGGCAGAA
GTGATGCGTGATGCGTGATGCGTGAGGACGAGGACATTGCTGACGCGGCTTGTGCTCGCCACATTTCTAGGCTCTTGTCG
ACGGACCTGCGACAGAGGCCAACCCTGGTGGCGTGCCTCGGCAATCGATCTCCTTCTCGGACGTGCTTCTCACCGGCATA
GTGGTGCACCAGCTGACCCTCAGCGCGCGGTCGGGTGCGGTCAAGCGCGCCTGGGAGGCGGCCAAGGTCGACGAGCAGTG
GAAGGCGAGCAACTGGTACAAGAAGCGGGTGCAGAACGAGCGGCGGAAGGCCCTGACCGACTTTGACCGCTTCAAGGTCA
TGCGGTTGAAGAAGCAGCGGCGCTTCGAGGAGGGCAAGGCCCTGGCCAAGATCAAGGCCAGCGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62