GenePrediction:GLEAN_3383 Details

Name: GLEAN_3383
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:1039133..1040221 (+ strand)
Length: 1089
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:1039133..1039676 (+ strand)
Length: 544
Type: CDS
Source: GLEAN
Position: GCSC_89:1040001..1040221 (+ strand)
Length: 221
>GLEAN_3383 class=GenePrediction position=GCSC_89:1039133..1040221 (+ strand)
ATGGGCCTCCACGTAACCCCATATGGCACTTTCTACGTTCAGCGCAGTCTGCGCACCGGCGAAGTGATGCAAGTGTTGCC
TGTTCGGCGACCGGAAACACCCAGCCACCTGCCGTCTGTCGACTCTCTGGGTATTACTGACAATTTCATCGAGCGTCGCC
GCGCTTCCATCGCTGCAACCAATGCCCGAGCCTCGCACCCCCAGGACTCTCTGCAGCGCGAGCTTGCCTCCGCCGGTGGA
GAGCGCCTCTTGGAGACAGGTAAGGCGGTGTTGGCGCAGCGGGACGATGGCGATGTTGAAATGAACATGGGTAATGGCAA
TGGCAGCGGCAGCGGCAGCGGCCGAGGAAACGAGGCTGGCGGGACATTTTCTGCTCCTGCAGCACCGGGTTGTGACAGCA
GCAGCAGCAACAGCAGCTCTCACCATCATCGCCACCACCACCAAGTGAACACCGACCCCCATCACCCAGAGATGGTTTTT
GTCCCCCGCCGCCAATGGCAACGGTACCGCACGTGCTTCCGGTCCGTCCCTGGCCTGAAGCGCTGTAGGTTGCATGTCTT
GGTGGGGCGGATGGCAGAAGAAGAGGGGGAAGTCGGACAAGGACGCTCAGCTAATGTGTTTCTTTCTTTCCCCCTCGGCG
TCCGCAGACCTCAACGAGAGCCGGTCAATCTTCCATCCTTTTGCCAGATAGATTCGGCCAGGGCTCTGAGCCAAGACGGA
CAGTATGAGCACTACGAGCAGCACAGTCACAATCAACAACAACAGCAGCAACGACAGCACCATCACCAGCACCAACGCCA
GCACCAACAACCTTGTTCCGGGCGACACAACCCTCACCATCACCACGGTGTACCGTACAATCATGCAGGTCGCAGTCGCA
GCAGCAGTACGAGCAGCCACACTAATAGTGCTAGTAGCATGACTAGCCAGGACAGCGCGAGCAGCACGAGCACAGCAGTC
TATTTTCCCTTGCAAGACTGCCACCCCAGCGGCAGTAGCAGTGTTGGAGGCGCCAACATCGACGTGGCGCCAGCAGCACC
TGCGGGCTTCCGCTATCAACAGCAGCGGCATCGCACAGATAGGCTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62