GenePrediction:GLEAN_338 Details

Name: GLEAN_338
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1145483..1147576 (+ strand)
Length: 2094
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1145483..1145584 (+ strand)
Length: 102
Type: CDS
Source: GLEAN
Position: GCSC_167:1145741..1146781 (+ strand)
Length: 1041
Type: CDS
Source: GLEAN
Position: GCSC_167:1147019..1147576 (+ strand)
Length: 558
>GLEAN_338 class=GenePrediction position=GCSC_167:1145483..1147576 (+ strand)
ATGGCGAAGCGGCCGGCGCTCGAGGCGCTGGACGCGATGGAGGGAGTGAAATTGCCGGCGCCCAAGAAGCAGAAGAGCGG
GGGGCAGCGGGAGGGCGGCGAGGTGGGTGTCAATGGTGCCCGAGCAGGACGGCGGCTTGGGAAGCTGGTGGAGGACCAGG
CCGACGATGACGACGATGACGATGACGAGGGCGACGACGAGGCAGGAGAGGCGGCGGAAGCGGCAGCAGCGGCTTTGGCG
ACAGGGCCAATTCGGCAGGCGGCGCCGTCGGCGGGCTACGGCGATCTCTACCTGGACACGATTGACCGCAACGTGCTGGA
TTTTGACTTTGAGAAGCTCTGCTCGGTGTCGCTCAGCAACATCAACGTGTATGCCTGCCTGGTATGTGGGCGCTACTACC
AGGGCCGCGGGCCGCGCTCGCACGCGTACTTCCACGCGCTCGACGAGGACCACCACGTGTTCATCAACATGCAGACGCAG
CGGGTGTACGTGCTGCCCGAGGGCTACGAGGTGCACAGCCGTTCGCTGGACGACATCAAGTTTGTGGCGGATCCGCGGTA
CACGCGGGCAGACGTAGCCGGGCTGGACGGCGGGCGACGGCAGACGCAAACGCAAACACAAACGCAACAACATCACGTGA
CACTGGCTGGTCGGCCATATGCGCCCGGTTACGTGGGCATGAACAACATCAAGGAGAACGACTACCTCAACGTGGTGGTG
CAGGCGCTGGCCCACGTGCCGCCGCTGCGCAATTTTTTTCTGCTGGACGAGGTGGCGGCCCAGGAGGCGCGGCGCCGCAG
CAGCAACACGGCGACGACGGGCGAGAAGCGTCCGGAAGCAGCAGCCAACCGCGAGCTCGTCCGGCGGTTTGGGCTGCTGG
TGCGCAAGATCTGGAACCCGCGCGCGTTCAAGGCACACGTGTCACCGCACGAGCTGCTACAGGAGGTGGCACTGCGGTCC
AGCAAGCGGTTCACGCTGACGGCACAGTCCGATCCGGCCGACTTTCTTGCCTGGTTCCTCAACCACCTGCATCTGGGCCT
CGGCGGCAGTCGTTCTCGACCGGCCTCGTCCATCGTTCAGCGCGTCTTCCAGGGCCGTGTGCGCGTCCGCTCCGAGACCC
TCGCCGCTGTCGGTGCCCGTGCTGCTGCTGCTGCGGCCGACGACGCCATGCAGGTCGACGACGACGACAATAACGACAAG
GCTTCGTCCTACCACACCTCTGGACCCCTTCCGGCCACCGCTTCTCCGTCTCTGCCACCACCACCACCGCCTTCATCCTC
TATCCCACCGCCGCCCGGCGTTTCTCTCCCTCTCGGTGCTTCCCGTCCACCACCGCCCGGCCTCTCGGCTCCAGGCGTCT
CGTCCTCGGCGTCTTACTCTTCCTTGCTGCCGCCTCCGCCTCCACCTCCGTCTTCGCTGGCAGCACCAACACCAACAGCA
GCAACAGCAGTAACAACAGCGTCTGTTCCCGCGGCCGCTGCCGTCTCGCGCTTCCTCCTGCTGACACTCGACCTGCCGGC
CGCACCGCTCTTCCAGGACGAGCAGGAGCGCAACATTATCCCGCAGGTGCCGCTGGCTGCGCTGCTGGCCAAGTACGACG
GCGAGTCGGCCCGCGAACAGGGCGACGTGCGCCGCCGCTTCCGCCTCCAGGCACCACTGCCGCCGTATCTCGTCCTGCAC
ATCAAGCGCTTTTCGGCCAACAAGTTCGTCGCCGAGCGCAACCCGACCATCGTCACCTTTGACCCGCTCGGCCTCGACAT
GCGTCCCTTTGTCGACGGCGAGCCCGGCTCCGCCGATAGCCCAATCCCCTACGACCTCGTCGCCAACGTCGTCCACGAGG
CCGTCCGTGCCGGCGGCGATGACGTCGCCGTCGATTCGGCCGAGGAACGCCGCACTTGGAAGGTCCAGCTGCGTGAGCGC
CAGGCGGCAGGAGCGACCCCGCCTGCTCTTGCCGCGCCCGCCACCGCCGCCGAGCAGGACAAGTGGGTCGTCGTCCAGGA
CCTCTTTGTCGAGCCGGTCGCCGGCGAGCTGCTCTATCTCGCCGAGTCCTACATCCAGATCTGGGAGCGTCGCCGCCCGT
CTGCTCCTTCGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62