GenePrediction:GLEAN_339 Details

Name: GLEAN_339
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1152050..1153642 (+ strand)
Length: 1593
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1152050..1152115 (+ strand)
Length: 66
Type: CDS
Source: GLEAN
Position: GCSC_167:1152188..1152487 (+ strand)
Length: 300
Type: CDS
Source: GLEAN
Position: GCSC_167:1152542..1153259 (+ strand)
Length: 718
Type: CDS
Source: GLEAN
Position: GCSC_167:1153368..1153642 (+ strand)
Length: 275
>GLEAN_339 class=GenePrediction position=GCSC_167:1152050..1153642 (+ strand)
ATGGCCGACTACGAGTATACTGGCGGCAGCACAGAAGCCAACCACCTCTGTGTGCTCGTCCATGGGGTGCGTTTCTCGAC
AGTTGTGTCTGCCTTGTTCTGAAAGAGCTCTGATTTCTAACGATGGGCGATATGACAGCTCTGGGGCAATCCCGGCCACA
TGGCCTCAATTGCAGAGGCCCTGCGGGCCAAATACCCGGAGGACCAGCTGAACCTGCTGGTAGCCAAGAGCAACCGGGGA
ACATTTACGTACGACGGCATCGAGACCGGTGGCGAGCGTGTGTGCACAGAGATCGAGGAGGTGCTAGCCAACGTCGAGGC
ACGCGGCGGCCACATTACGCGGCTCAGCGTGATCGGCTACTCGCTCGGCGGGCTGGTGGCACGTTATGCCGTCGGCCTGC
TGCATGCCAAGGGTGTCCTCGACACGCTGGAGTGCATGGTGAGCCAGCCCGGGATGCCGTCCCCTTATCGAAATCGTGCT
GACAGCAGCTAGAACTTTACTGCCTTTGCCAGTCCTTTTCTGGGCGCCCGTGCTCCTCGGCTGGGCGTGGCCAACAAGGT
GTGGAACACGCTGGGCGCACGCATCCTGAGCATGTCCGGTCGCCAGCTCTTTGGCATCGATGCGTTCCGCGATACCGGCC
GGCCGCTGCTGGCTGTCCTGGCTGACCCCAACTCCATCTTCATGGCCGGCCTAGCCCGGTTTCGTCGCCGCACGCTGTAC
GCCAACATCATCAACGACCGCAGCGCGGTCTACTACACGACGGCGATCGCCAAGACGGACCCCTACGCAGCCGTGCGGGC
TGACGGCGGCGAGCTGGACGATCTGTCTCTCCAGTTCGTGCCGGGCTACGAGAGGGTCATCCTCGACCGCGACGAGCCCA
TCGACTGGACCAAGCACCACGCCATGTCGGCCCAGCTGCAGCTGCTGCACCGCAAGTCCAAGGCCCGCTGGCTGCTCGAG
ACCGTCGTGGCCAGCCCGTGGTCCAAAGAGGCGCGAGCAGCGCTGCTAGACGTGGCGCCCGTGTTCGCCCTCGTCCTGCT
GCTGCCCATCGGCCTGACCGCCTTTCTGGTGCACTCGGCCTACGAGACGGTGCGCAGCCGGAAACGACGCGAGCGACACG
AGAACGGCCTGGCCGGCATCGACGTGGTCCAGTACCGCGTCCCGCTGTGGATGAAGAGCCTGCAGGAGTCAGCCGAAGGC
GCGTACGAGAGTCTCAACAGCGCCCACGAGCCGGATCATCTGGCTTACGGCGACGGTGACGACAACGACGAAGACGGCAA
CGAGGCTGCGGAGCTCGACGCACATCTCGTCTACGAAGACCAAGGCATGTCGGCTGTCGAGCAGCAGCAGCACAGCTCCG
AGGTGGACCACTCAGATCCGACGGCTTCGAAACACGAGCAGACCCTCGCCCTCTCGCCCGATCAGTTCGCTATGATCGAC
GCTCTGAATGCCCTCGGCTGGCGAAAGTACCCCATCTGGATTCACAAGATGCGCCACAGCCATGCCGCCATCATTCGGCG
CCGTCCTGAACCCATGTACGACGAGGGCAACATCGTCCTCAAACACTATCTTGAAGAAGAGTTTCTCATCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62