GenePrediction:GLEAN_33 Details

Name: GLEAN_33
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:236050..238031 (+ strand)
Length: 1982
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:236050..236571 (+ strand)
Length: 522
Type: CDS
Source: GLEAN
Position: GCSC_179:236634..238031 (+ strand)
Length: 1398
>GLEAN_33 class=GenePrediction position=GCSC_179:236050..238031 (+ strand)
ATGTCGCGCATACAGATCCCGCTCGACATGATCACGTCGCGGTTCAACTTCGGCGACCGCTTCGCGAGCGTGCGGTCGAC
GTCGCTGGCCACGCGGTTCTCCAACCTGCGGCCCCTGACTGAGTTCTTCGACGTCAAGCGGATTTCGAAGCCGGAGAACT
TTGCGGAGATGCAGTCGCGCGTCAACTACAATCTGGGGCATTTTTCGAGCAACTACGCGATCGTGTTTTTGATGCTCTGC
ATCTACACGCTGCTGACCAACTGGTGGCTGCTCTTCGACATCATCTTTGTCGTCCTGGGCATGTTCCTCATCGGCAAGCT
GGACGGCAATGACCTCGAGATCGGCACGTTCCGGGCGTCGACGTCGCAGCTGTACACCGGTCTCTACGTCATCGCCATCC
CGATCGGGCTCATCTCGTCGCCGTTTGCCACCATCGCCTGGCTGATCGGGGCCAGCGGCGTGGTGATCATTGGTCATGCG
TCTTTTATGGACAAGCCCATCGACGAGGCTTTTTCTGGGGAGGTGGTCTAGATGGTCGGCCACGTGCTCCCAAACACAGC
CCCTCCTGGGGAAGACCATCCAAGCGCGGCGCCCGAGCGGGCAAGAACAACAACCGGGATTCTTATATCAGCGACAAGGA
CATTTGGAGTTCCTTCACCAGCGGCAGCCGCGTGGTGGAGGAGGTGGAGAGCAGCAGCAGCGGCGACGGCGGCGGTGGCG
GCGGCAGTGGCAGAAAAGGGAAGGCCAGCCTAGCAAGAAGGCACCGGGGACAGGGCGTTTCGGATGCATTTTCAGCGGAT
GCGGGAGTGACCCGGCGGCGAGGGAGATTGATGCAGGCAGAATCAGGCTCGGACAAGGATGACGACAGCTCCGAGTCGGA
GTCGACGTCTGAGAACTCAGACTCCGAGTCGGACATCAGCGAGCCGGGCGAGGAAGAAAAGGCGGCCTTGGCCAAGGCCA
TGGCCCGTATAGAGCGAGCCAAGGCCAAGGACAAGGCCCAGGTGAAGCTGAGCAAGAAGGAGCTGACGGCTCTGGGACGG
CACAAGGAGCGGCTGCAGCGACTGGAGCAGCAGAAGAAGCGGCGAAAGGCGAAGAAGGAGAAGAAAGGGAGGAAAGACGA
GAGAGAGCGGGTAGCGATTCCGCTGGCGCATCTGGACTTTCCGGCGATGCGCACAATCGGGAGGCCGCCGTCGCCACTTC
TGTCGGGGGACGACAAGGGCGAAGCACGTCGCGTGCCTGGGGCATTTGAGCGCGAGGAACGGCCGAAGAGCGAAGTGTAT
CCGCCCAAGGGCCAGCTTCCGCCGCCACGACCGCTCTCGATGGCCAGCGGTGTCGGTGGATCGGACCGGCGACGCAGCGC
GTCTCCCTTTACCTATGCGTACCTGCGTGGCAGCGGAGCGGCGACGGCATCGACAGCAGCGGCAGCCCGACACGTGTCTG
ACCCGACCGCATCGCAGGGCAATGTCAATCCGTTTCTGTTCATGACGGGAGAAACACAGACGCCGTACTATGGGTCGGTG
GCAGCGGCGGTAGAGCGGTTCGGCGGGCCAGCAGTGGCTGCCACTACAGCCCGGAGCCGCGTAGACCCGTTGCTGTACGA
GGTGTCGGAGTCGAGCGGTCAGGACGAGACAGCGAGCGGCGACGAAGACATGGGGGACAGGCGGCGTCGGTCAGTGGTGG
ACCACACACAGTCGCAGACTCGGATGGTCGATGACGGGTTGTCCAGACGGCGTGGACGGGAGGCCATTGTCCATGCGAGC
GAGTCGGACTCGGAGGCCGGGGCAGATGGGCGGGAACGGGACCGTGAACGGGATCGTGAACGGGACAGGGAACGGGAGCC
GGAGCTGCGGCCGGTACAAGAGTCCAAGGCGAAGAAGTCGATGCGCAGCTCGTCGACGGCGATGGCGTCCAAGCACAAGA
CCAGCAGGACGCGCAACAGCAGTCCCAGCGTGCAGCCGAGCCGTCGGAGACGGGCCAAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62