GenePrediction:GLEAN_3407 Details

Name: GLEAN_3407
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_142:102841..103717 (+ strand)
Length: 877
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_142:102841..103038 (+ strand)
Length: 198
Type: CDS
Source: GLEAN
Position: GCSC_142:103185..103358 (+ strand)
Length: 174
Type: CDS
Source: GLEAN
Position: GCSC_142:103523..103717 (+ strand)
Length: 195
>GLEAN_3407 class=GenePrediction position=GCSC_142:102841..103717 (+ strand)
ATGGAGAAGAAGGCAAGGGGAAAGACGCAGAGCCAGGAGGAGGTGGAATGCAAAAAGCGGGAAGAGAGGAGCGAAAAGCG
AAAAGCGAAAAGCGAAAAGCGAGAAAAGAAAGAAGCAGACAAATCGACAGGACGGCCAGAAGGAAGGACCGACCAGATGA
AGGGCGACTGCGGCGGTGGTGGCAGTGGCAGCAGTGGTGTGTGTGGTGTGGTCGTGGCAGTGTTTTGTTTTCTTCGCTCG
GTCTTGGCCTGGCAATCTCTCTCGCCCGAAGGAGAAGGGAGGAAAAGCTGGCCGAGAGCCAGGCAGAGCCCGTCGGCCAC
GTCTGATTGGCCGGCTTTCTACAGGGGCCTTGGGCGCCGAAGGCCCAGCAGCAGGACGCTATAATTACTCTCCGGATGCT
GGGCTGTGCTCCATCCGCCTGCAGCAAAGAGTGCATGCACAGCACAGCTGCGCAGTCCATCCCAGCCCTCCTGCGCCGAT
CAGGCCGCTGCTGCTGTGCTGGCCGCCGCGGCTTTTCGGTACGTCCAACGAGCCCGTGCAGGCCTATCGCCGAAAACAAG
ATGATGAATCAACCAGGACCGAACCAAAAAAAAAAAAAAAAAAAAGATCAAATCCAAAAAGAGTCAAAACCGAAAAAAGA
CGGCCCCATCGACACCTCATCCTCGCTTCGCCAACCTGCCAGCCACCCTCTCCTTCTGCGCTGTTCCATGCCGTCTTCCG
TCGTCCGTCTCTCATCATCCCCATCTGCCTGCCCCGTCGCCACTGCCCCATCGCACCAACGCTCTCCCAGACCCTCGTAT
CCCCCCACAGCTCATTTCGCTCTACCCGTTTCCCGGACAGCCTCCTGGGTCGGCTGCCAATCTCGCGCCCACGCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62