GenePrediction:GLEAN_3408 Details

Name: GLEAN_3408
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_142:107700..111035 (+ strand)
Length: 3336
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_142:107700..109091 (+ strand)
Length: 1392
Type: CDS
Source: GLEAN
Position: GCSC_142:109150..109588 (+ strand)
Length: 439
Type: CDS
Source: GLEAN
Position: GCSC_142:109641..110833 (+ strand)
Length: 1193
Type: CDS
Source: GLEAN
Position: GCSC_142:110955..111035 (+ strand)
Length: 81
>GLEAN_3408 class=GenePrediction position=GCSC_142:107700..111035 (+ strand)
ATGGCTGACTACACCATGTTCCACGCCCTCGGCCAGGGCGAACAGCTCGACCCCAACGACCCTCGTCTCACCCAGCCGGC
CGCTCCCATGTTCCAACCCCCCATCGCCCCTCAGTCCTACCTCCAGCCGCAGCAGCCAGGCGCTCAGCCATACGGAGTGG
CGGCTGCTCCTCCGGGCCTGCTTGCTCCAGCACAGGCGCTGAGCCGGGCCACGAGCGCGTACGACCTGCGGGCACAGGAC
AACCCGGGCTTTGGCCCGCGTCCCGGCACAGCTGACGACAGCTTAGCAGCCCAGATGGGCGGCATGTCTCTCGGTGTCGA
CGGCCATCACGCGGCACGACGGAAGAAGAAGGATCGTCACGCCTACCACACGGTCGAGGCACCCGTCGGCTCATCCATGG
GCTTCTTAGCAAATCCTGCCGGCTCTGAGCTGATCCCGGGCGCGTCTGGTTTCGTCCCTGCGGCGTCCATGATGCCCGGC
TCCCCGTTTCCAGCAGCAGCAAACGCGCCTTACACGCCTGCCAACCCCGCTGATCCGGCCAGCTTTGCGGCGAGAAGCGG
AGGCGGCGTCGGCTTTGGTGTGCCTGGGGCTGCTCCTGAGGTGGGCGCGTCGCCTGCCGTTGTCGCAGCCTCGGGCCAGC
AGAAGGTATCTCCCGACGACATCCCCAGCATTCCACTGGCGCGAGACACAGCACAGCAGCACTTCCTCACCAACATATAT
CCGACGTTTGAGCGCCATGTTGCGCCGCCGGCTTCGATCTCGTTTGTCGCTCTCGACCAAGGCAATGCGTCGCCCAAGTT
CGCGCGGCTCACGATGAATAACATCCCGGCCACGGCCGAGGGCCTCCACAGCACCGGACTGCCGCTGGGACTGCTCCTGC
AGCCGCTCGCCCCGCTGCAGACGGGCGAGTCGCCCATCCCGGTGCTCGACTTTGGCGAGGCCGGCCCGCCTCGGTGTCGC
CGGTGCCGCGCCTACATCAACCCGTTCATGGTCTTCCGCTCGGGCGGCAACAAGTTTGTGTGCAATCTGTGCACGTACCC
CAACGAGACGTCGGCCGAGTATTTTTGCGCGACGTCGCCGCAGGGCGTGCGCATCGACCGCGACCAGCGCCCAGAGCTGT
GTCGCGGCACGGTCGAGTTTGTGGTGCCTAAGGAGTACTACACCAAGGACCCGGTCGGGCTGCGCTGGCTGTTTGTCATC
GACGCCACGCAGGACTCGTATAACAAGGGTTTCCTCGAGGCCTTTTGCGAGGGCATCCTCGGCGCGCTCTACGGCGGCGA
AGCGGCCCAGGAGGCGGCCAGTGAGGACGACGAGCCCCGACGGAGCATACCGGCCAACGCCCGCGTCGGCTTTGTGACCT
TTGACAAGGAGGTCCAGTTCTACAACGTCAGCGTACGTGTCCCCTCAACCTGTTGTCGCCGTGCTGTCGTCTGCTAACGC
GTCCGTGCAGGCCAATCTAGAACAGGCGCAGATGATGGTAATGCCCGATATCGAAGATCCGTTTGTCCCTCTCAGCGACG
GGCTGTTTGTGGATCCTTACGAGTCGCGGGCGGTGATCACGTCGCTCTTGACGAGGCTGCCACAGATGTTCTCGACCATC
AAGAACCCGGAGCCGGCACTGCTCTCGACGCTCAACGCTGCCATATCGGCTCTGGAAGCCACCGGCGGCAAGGTAATCTG
CTCGATCTCGGGACTGCCGACCTGGGGTCCCGGCCGGTTGTTTTTGCGCGACGACGGCAAACACATTGGCGGCGAGATTG
ACAAGAAGCTGTACACGACCGAGCATCCGGCATGGAAGAAGGTAGCCGAGCGGATGGTGGCTGCTGGCATCGGCACGGAC
TTTTTCATGGCTGCGCCGTCGGGAGGCTTTCTGGACGTGGCCACGATTGGTGAGTTTCTGGCTCTGCTTCTTGCGCCCTG
TGTTTTATGTTAACAGTCCAGGACATGTGTCGTCGACCACGGGCGGCGAAGGGTTCTACTATCCCAACTTTGTGGCAGGC
CGAGACAACGCCAAGCTGTCAGCCGAGGTGAAGCACGCAGTGACGCGCGAGACAGGCTACCAGGCGCTGGTCAAGGTGCG
GTGCTCAAACGGACTGCAGGTGCTGGGCTACCACGGAAACTTCATCCAGCACACATTCGAGGCGGACCTGGAAATGGGGT
CGATCGACGCAGACAAGGCACTGGCGATCACGTTCAGCTACGACGGCAAGCTGGACGCGAAGCTGGACGCACACTTCCAG
TCGGCACTGCTGTACACAACGGCCAGCGGACAGCGACGGGTGCGCTGCAGCAACGTGATTGCGAGTGTGAGCGAGAGCGC
GCGCGAGGCGATGAAGTTTGTGGACCAGGACGCGGTGTGTTCGGTGTTGGCCAAGGAGGCGGCGACGCGGCTGGGCCACA
CGTCCAGCTCGCTGCGTGAAGTGCGGCAGGGGCTGACGGAGAAGACGATCAGCATTCTAGCGGGCTATCGGAAGAACCAC
GCGTCGCAGTCACACCCGCCGAGCCAGCTGATCATGCCGGAGCGGCTCAAGGAGTTCAGCATGTACATGCTGGGCCTGCT
AAAGTGCCGGGCCTTCAAGGGTGGCAGTGAGGCGACAGACCGGCGCGTGCACGAGATGCGCATGGTTCGATGCATGGGGG
CACTGGAACTGAGCCTGTATCTGTACCCGCGCATCATCCCGTTGCACACCCTGCAGCCGGAGGAGGGCTTCCCGGACCCG
GAGACGGGCCACCTGCGACTACCGCCGGCCATGCGCGCGACGTTTGCGCGTGTTGAGCCGGGTGGCGTGTACCTGGTCGA
CAACGGCCAGCAGTGTCTGATCTGGCTGGAGAAACAGACGTCGCCCAATCTGATCGCCGACCTCTTTGGCGAGGACCGCC
AGACGCTGCAGAGCCTGGATCCCTATGCGTCGTCGCTGCCGGTGCTGCAGACGCTGCTCAACGCCCAGGTCCGCAACATT
CTCGAGTTTCTCAAGACCCTGCGCGGGTCCAAGGGCCTGACCATTCAGCTGGCCCGCCAGGGCCTTGACGGCGCCGAGTT
TGAATTTGCCCGCCTGCTGGTTGAGGACCGCAACAACGAGGCCCAGAGCTACGTCGATTGGTTGGTGCACATCCACAAGG
GCGTGCAACTAGAGGTTCGTTGATCATTGGGGGCTTTTTTCATTTTTCCTCTTTTTCTCGTCTTTTTCTTCTTTTCTTTT
TTCTTCTTTCCTGTTTCTTTCTCCTCTTCTCCACCCTCCTTCTAATATCTTACAGCTTGGCGGCCAGCGAAAACGCGAGG
ACTACGGGGATGGATCGATGACCTCGTTTGCCGGACTACGATCTTCGTACTGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62