GenePrediction:GLEAN_3409 Details

Name: GLEAN_3409
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_142:117394..119287 (+ strand)
Length: 1894
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_142:117394..117809 (+ strand)
Length: 416
Type: CDS
Source: GLEAN
Position: GCSC_142:117903..118020 (+ strand)
Length: 118
Type: CDS
Source: GLEAN
Position: GCSC_142:118100..119287 (+ strand)
Length: 1188
>GLEAN_3409 class=GenePrediction position=GCSC_142:117394..119287 (+ strand)
ATGCGGGCCCCTCTTCTTCCCCTGCTGCGGACACGCTCGTCTCTGGGCTCTGCGGCCGTTGGCGCCGCCAACACCCGAGT
GTCTGCTTATGCTCTCGCCGTCGGCCACCGACAAAGACGGTCATGCATCGCCAGCTTGCTCTCAGCTGTGCCAGACAGCA
ACCGCTCCTTCTCGCTGAGCCAGCCATGCCGAGTTGATGACGGCCTGCAAGCGCCTCTGCCTTCGTCTTCGTCGCTGCTT
CCCACTTCGGTTGCCGGATTTCTCGTCTGGAAGCCCGCTGACCCCGTTGCCGACGTCGCCGTTAACGGCTTCGTTCGCTC
GGTACGGTCCATGAAGTCAAACACCTTTGTCACCCTCGGCGACGGGTCTTCTCTGGCCCCTTTGCAGGCCGTAGTTCCTG
CTGACTTGGCTGATGGGTGGGCGAGCCTTTCCCTCTTCTGAGCCTGAGCTGTTGCCCGTTCTTTGAATTTCTGCTTCGCT
GCTGTTCTAACACAATGACTCTTTCTCAGTCTTGCCAATGGAGCTGCAGTTTGTCTCAAGGGCTCATGGGTGCCCTCACC
CGGTGTCGGCCAGAGCCACGAGCTGCACGTCCGGTCTGTCGACATCTTGGGACCGTCCGACGCCAAGGTCTGTTGCTGTC
TCCTCCTGTTCTCTCTTTTCTTTCCCTTTCGGCCACTGACCAGGACAGACTTTCCCTATCCAAAAGAAGTACCAGACGCC
CGAGTTTCTCCGCACACTGCCACATCTACGTCCCCGCGTGCCGTTTAACTCGACCCTGCTGCGGCTGCGCTCCAACGTCA
TCTCATCTCTGGACCGGTTCTTCACCAGCCGCGATTTTGTGCAGACGCACCCGCCGCTGATCACCTCGTCGGACTGCGAG
GGCGCCGGCGAAGTCTTCACCGTGTCAGCCGCGTCGTCTGCTAGTAGCAGCAGCAGCAGCAGCAGCAACAGCCCGTCCAA
GAGCGGTGATGCGCACTTCTTCCGCAGCCCAAAGTACCTGACCGTGTCGACCCAGCTGCACCTAGAGGCGCTAGCACAGG
CCGTCGGCAGCGTGTGGACGCTCTCGCCGACCTTCCGCGCCGAAGAGAGCGACACGCCGCGTCACCTGAGCGAGTTTTAC
ATGCTGGAGGCCGAGGTCTGTTTTGTCGACCGGCTCGACGGCGTCATGGATCTGGTCGAGGACATGCTGCGTGCCGTCGC
CGCTGACGTTCAGGGCAACCGTGTGGCGGACGAACTGCTGGCCCGTCCAGGTGGCAGCAGCACCGACGACCTGGCTCATC
GCTGGCAGGGCCTCGTGCAGCAGGATCGCTGGCCGCGCATCACCTATGCCGAGGCCCTTCGCATCCTGGCCGCTGCGCCT
GGGCGCTTTGACTTTGCACCCACATGGGCCACAGGCCTGCAGACTGAGCACGAAAAGTATCTCGCCTACGCTGTCGGCGG
CGGCCAAACCCCCGTCTTCGTCACCCACTACCCGCGTGACATCAAGGCCTTCTACATGCTGCCGAGCAGGGACAATGCCG
GCGAGCCGGGGGAACTCCCGGCTGTCTCGGACGGCCAGCAGCCCGTCTCTGCCGCCACCGTGGATTGTTTTGATCTGCTG
GTGCCCGAGTTCTGTGAAATTGCCGGCGGCTCTATGCGCGAACACCGCCTGCCCGAGCTGGTCGCGGCCATGCGCTCGCG
CGGGATGCAAGTCGCCGAGGACGGTGCACCTTCTGGCCAAGATGGAAGCAGCAGCAGCGACCTAGACTGGTACGTTGATC
TGCGTCGCTGGGGCTGTCCTCCCCATGGCGGGTTCGGCGTCGGCTTTGACCGTCTGCTCTGCTACCTGTCGGGCGTACAG
ACAATCCGTGACACGGTCGCATTTCCCCGATGGTTTGGTCGGTGCGACTGCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62