GenePrediction:GLEAN_340 Details

Name: GLEAN_340
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1154267..1156594 (+ strand)
Length: 2328
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1154267..1156594 (+ strand)
Length: 2328
>GLEAN_340 class=GenePrediction position=GCSC_167:1154267..1156594 (+ strand)
ATGAGCACCCAACTCGGCCTCCTCAAACACATTCCCTGTCCCAGGGGAGAGGCCTGCACCGCCTATCGCTGCCTGTTCCG
CCATGCTGGAGATGACGACAGATGGCCACTACCAGGCGTCCAGGACCCGTCGGCCCAGCCTTTGGACTCGCCATCGACTC
ATGACCCAAGTGCTCAGGTCGAGTCTGCGACACTGTCCCTGACTACTGGCGGCGCGGCCGATCAGCAGGCCGATCAGGCC
GATCCTGTGCAAACAGCTCCTCGAAAACGGGTCAAGCTAGGTGATGGCGAATACGATCCCACGTCGCCTCCCATGCCCCT
GGATTTGTGTCTGGGATCTCATGATGCAGAGGAATTCGCAGGACAGACCAACAAGGTCACCTCTTCTTCCGAACCAGCTG
TCTCCTCTGCTGAAACGGCTCTCCAGACGGATGCCATCTCCTCATTGCGTAAGCGGCCAATCTCACCGCCTCCGCTTAAA
CGCAAGGCCACTGAAGCACCAGCCAAGACAGCCCTGCCCAAACCGGCCTCAGGATCACGCAGAGCAGCAGCTACGGCCTT
GGCTGTACCGCAGAATTTCTCCACAGAGCGAGTATTAGACTCCCCGCGTCCGACAAGCTCCTTTGGCGGCAGCAGCACCA
TCAGCACCGCTGCCAACAACAACAACAACCACAGCAACAAGACTACCAACCATGCAAGCGTCCCGACGGCCTCGGAGGCC
ACGACAGTGTCGCCTAGAAAGGCCGAAACGCTCAACCCACGGCATCTCGGGAAAGCTCCAGCGACTCATGATATCCGCTT
TAAGCTAGTGAAGATGTTGCACGCCGAATTCTTCCGTCTGAACAGCGAGCTTCGCACCAACGGCAGCGAAGACGACAAGA
AGAAGCTCCTCATGTCGGCACAGGAGCTCGTTTGGCTGACTTTGGACATGGAGGAGAATTGCGCAGTCAGCAAGCCGGCA
ATCTACTCCAATACGATCAAAAACCGCATCATGTCATACAAGCGGATGTCGCTGGCCCAATGGACGAAGGAACGGACAGA
CATACGAGAAAAGGACCTGCGTAAGCAGCAGAGCGCAGAAAGAATAGCGCAGGGCCAAATGCAGCAGGGCACTGGCAGCT
CTCGAGACACAGGGAAAGACACAGCCGAGCCCGTTGTTCTCGAGACGGGACTCACCTCGGCAGAAGAGGTTGCCTTCCTC
AAAGAGAACCTGCTCACGCCGATCCAAAGCCTGGCAAACCACGGCTACGTTCCGGCCGTGCTCCTGGAAGCAGAGATTCA
GAAAGCCCGCGAAGCTGCAGAGGTTTCCAAGGGATGGGAGCTATGTGACCGCTGCGGAACACGCTTCCAAGTCTTCCCAG
GCCGTCGGGAGGAAGACGGCGCCCTGACGTCGGGCGGCTCGTGCACCCATCATCCGGGCAAGGCTTTCTTCCCACCCAAG
GCGGCCATGGCCGGCAGCGGCGCCAGAGACAACACGAAGCGGTTCCGCTGCTGTGGACAGGCTGTCGGAGACTCTGCCGG
TTGCGTGACCACCACCAGCCACGTCTTCAAGACGAGCGATCCAAAGCGACTGGCGCTGCTGTGGAACTTCACCCAGACAC
CACCGAACCCCAGCGTGCCGTCCGATCGCGCCGTATGCTTCGACTGTGAGATGGGATACACCGTGTACGGCATGGAGCTT
ATCCGAGTGACAGCCACGTCCTGGCCCGATGGCGAAAGGCTGTTGGATGTGCTGGTGCGCCCGATCGGAGAGATCATCGA
CCTCAACTCACGCTATTCTGGCGTCTGGCCCGAGGACATGGCCAAAGCCCTTCCCTTCTCGGCCGCCACCGTCTTCGACA
ACAGTAAGAGCGAGCAGGAAGAGGAAGGGCGGCGGCAGCTGCAGATTGTGTCGTCTCCCGTCGTAGCTCGTGATCTGCTA
TATGCACTCATCAGCCCAGAGACGCCACTCGTCGGTCACGGCCTGGAAAACGACCTGAACAGCATGCGCATCGTGCACCC
AACCATCTGCGACACCATCCTGCTGTTTCCCCATCCTAAAGGCCTCCCTGTGCGCTATGGCCTAAAGATGCTGGTGGACC
GTCATTTGCATCGCCAGATCCAGGTTGAGCCACAGGGTGACAGCGGCGTGCTGATGGGGCACGACAGTGCTGAGGACGCC
CGGGCTGCTGGTGATCTTGTGCGTTTCAAGGTCAAGCAGGAGTGGGCGTCCAAGCGGACGGACGGCTGGGCTTTCATGGA
TGGGCATCTCGTTGCTCCTGGGACGCGGCCTGGCAGAGGTAGCTCTGGCGTTCTGACGGAAGCGTACATTGAGAAAGGGA
AAGGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62