GenePrediction:GLEAN_3411 Details

Name: GLEAN_3411
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_142:134882..135911 (+ strand)
Length: 1030
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_142:134882..134944 (+ strand)
Length: 63
Type: CDS
Source: GLEAN
Position: GCSC_142:135028..135054 (+ strand)
Length: 27
Type: CDS
Source: GLEAN
Position: GCSC_142:135240..135262 (+ strand)
Length: 23
Type: CDS
Source: GLEAN
Position: GCSC_142:135331..135655 (+ strand)
Length: 325
Type: CDS
Source: GLEAN
Position: GCSC_142:135747..135911 (+ strand)
Length: 165
>GLEAN_3411 class=GenePrediction position=GCSC_142:134882..135911 (+ strand)
ATGCCTCCGAAGAAGACTGAAACCGCCGCGGCCAAGGCGAAGGCTGCCCATGCCTCGTACCAGGTTTGTCGCCGCGCTCA
ATGATACCGCGACACGATTTAATTTGCACTGTCGCAATGTGGATTTTGCGCTAACTCTCGTCGCAGGATATGATTACGGA
TGCTATTGTCTCGGTAAATACGCACCATTCTTTGCAGCGTATAGTCACCTTTGCCCATTTTCTGTCTGCATGTCATGGCG
CAAGCTTGTCTCTTTTTTGCGACGGATTTTTTGTCTGCTGTGGCTCCCCCGCGCGCTTTGTTCCCAGCCTAGCCTCCATT
TGACCGCAGCATTCGCTAACGCAACCGCAACGGATCAGCTCAAGGACCGCAACGGATCAAGGTAAGTCGCCGTCGCGCCG
GCTGCGCTTCCCTCTCAATCTTCATTCAGTAGACTAACTCGACCGCCAGCCGGCAATCGCTGAAGAAGTATGTCAAGGCG
AACAACAGCCTGTCCGTTACGGACACTATGTTCGATTCCCTGTTCAACAAGGCGCTGCGGGCCGGCGTTGAGAAGGGCGT
TTTCGAGCAGCCGAAGGGCGCTTCAGGCGGCACCAAGCTTGCCAAGAAGGCTGCCAAGCCAGCCCCGAAGAAGGAGGCCG
ACAAGGTGAAGAAGCCCGTTGCCAAGAAGGAGGTCAAGAAGCCCGCCCCCCCTAAGAAGGAGGCTACCCCTCCCAAGAAG
GCTGCCGCCAAGAAGGAGGTGCCCGCTCCCAAGAAGGCTGCCCCGAAGAAGGAGGTCAAGAAGGCTGCCCAGAAGAAGGC
ACGTTGACCTTGTTTTAGTGCATCTCACCCCATACTTGCGGCCCTTTATTCTAACACATCTCTAGGCTGCTGCTGTTGCT
GCACCCGCTCCCGCTCCTGCTCCAGCCGCCGAGAAGCCAAAGGCCAAGCCGGCGACGAAGTCAGGCCGCGTCTCCAAGCC
CGTTGCCAAGAAGGCTGCGGCACCGAAGAAGGCTGCGTCGAAGAAGGAAAAGTCTACTGAGTCGGCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62