GenePrediction:GLEAN_3414 Details

Name: GLEAN_3414
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_142:149858..152089 (+ strand)
Length: 2232
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_142:149858..150073 (+ strand)
Length: 216
Type: CDS
Source: GLEAN
Position: GCSC_142:150152..151028 (+ strand)
Length: 877
Type: CDS
Source: GLEAN
Position: GCSC_142:151104..152089 (+ strand)
Length: 986
>GLEAN_3414 class=GenePrediction position=GCSC_142:149858..152089 (+ strand)
ATGTCCGGCAACACCGTACGAAACACGCCGAGCCGTGGCCAGGCCCGTGGGGCCATCCCCTTCAACAATGGCGGCAGCAA
CAGTCCGGCTCCCACGTCCAGCATCCCACGACCCGTTCTTGAGCCGCCGCACGGCGGCAGCCATCCTGGACCGGCCAGTG
ATGTTGGAGGCCCCTCAATCAGCGCCAGCCGGCAGAAGCAGTCAAAGCGCGACGAGGTGTGTTGTGGGAGAGAAAGGAGA
AAGAAAGAGAGAGAGAGCGCGCTCCTTGTATACCCCTGCTGACTCTGCGCCCAGGCTATTCGTCGCAAACTCGAGAGCGA
CCTGAACAAGAAGAACAAGAATCCGCAAGGCCGTGCCGGTCGCTCCCGCAAGGCACCGCCCGGCACCGTTCTCGCGCTCA
AGCCCAGCCCGGCTCTGCAGATCAAGCCGAACACGACGGTGGCCGAGGCGGCGCAGCTGATGGCAGCCAAGCGCGAGGAC
TGCGTGCTGGTGACGGATGATGACGACCGCATTGCTGGCATCTTCACGGCCAAGGACCTGGCCTATCGCGTCGTGGGCGC
AGGCACCAAGGCGAACTCGGTGACCATCGCCGAAATCATGACCAAGAACCCGCTGTGCGCGCGTACGGACACCAGCGCCA
CGGACGCGCTCGACCTGATGGTGCGCAAGGGCTTCCGCCATCTTCCGGTCATGGACGAGAACCAGGACATCTCGGGCATT
CTCGACATCACCAAGTGCTTCTACGACGCGATGGAGAAGCTCGAGCGCGCCTACTCATCGTCGCGCAAGCTGTACGACGC
TCTCGAGGGTGTGCAGTCCGAGCTGGGCACGAGCCAGCCCCAGCAGGTCATCCAGTACGTTGAGGCGCTGCGGTCCAAGA
TGTCGGGCCCCACGCTGGAGACGGTGCTTAACGGCCTGCCACCCACCACCGTCAGCGTCCGCACGTCGGTCAAGGAGGCC
GCCCAGCTGATGAAGGAGAATCACACGACCGCCGTGCTGGTCCAGGACCAGGGCGCCATTACCGGCATCTTCACCAGCAA
GGACGTCGTCCTTCGCGTCATCGCCCCGGGTCTCGACCCGGCCAACTGCAGTGTCGTGCGCGTCATGACGCCACACCCCG
ACTTTGCTCCCATGGACATGAGCATCCAGGCTGCGCTGCGCAAGATGCATGGTGTGTGGTCACTTGCTTCCTCTTCCCTC
TTGCCCTCCCCTGCATCATGACGTCCGCTGACCGATTCCTCTCCAGATGGCCACTACCTGAATCTGCCGGTCATGAACGA
CGGCGGAGAAATTGTCGGCATGGTCGACGTGCTCAAGCTGACGTACGCCACACTCGAACAGATCAACACAATGGCCAGCG
GCGACTCCGAGGGCCCGGCCTGGAACAAGTTCTGGCTCTCGCTCGACCACGAAACTGAGTCCATGGTCTCGGGCGATGGC
AGCCACCACCACACCCACAACACGAACCTCGGCTCGCGCATGATGTCGCCTGAGCTGAACCGCCACCAGCGTGTCGACAG
CGTGGCGCCGGGAGATTCTGCCTCCCATGTCGGCATCGAGTCGCCGACGCGGTCGTTTCTTGCTCCTCCCACGCCGGAGC
TGCCGCCCAGCGAGACGCCTTTCCCGTTCAAGTTCAAGACTCCGAGCGGCCGCGTGCACCGTCTGCAGGTGACGGCCACG
CATGGTGTTGCAGTCTTTGTGGACAATTTGGCTGCCAAGCTTGGTCTCGCGGAGGTGCTTTCTATCGGCGGCAAGCCCGA
TGTGGAGGACGGCAAGATTCTGGGGTCCGGATTTGCCATCAGCTATCTCGACGACGAGGGCGACAGCGTTTCCATCACGG
CCGACCAGGACCTGCTAGAAGCCATCTTGCTGGCACGCCAAAGCCACCAAGAGAAGGTCGACCTCTTTGTACACGACCCA
GAAAAGCCGCCAATGGCCTCAACACCGGTCATCACGTTGGAGCCGGCTCCGAGCAGTATTCGAGAGCGTCGGCGCGGCGG
GCGCAGCACGATAGACACATCTGACTCAGAGGAGGAGGACGACCGTAGCCACCACAACAAACGGCGGCATCACCGTGGCG
GCCATTCACAATTGGGCGGCCCGGGCGGTGCTTATGGCGCAGAGGAGCAGCTGATTGCCGGCGTGCCGAATGATCTGCTG
CTGCCGGGCGCCATCGTGTCGTTGGCTGTTGTCATCCTGGGCGTTTTTACCATTTCGCGGTTGACCAGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62