GenePrediction:GLEAN_3417 Details

Name: GLEAN_3417
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_142:168746..169422 (+ strand)
Length: 677
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_142:168746..169091 (+ strand)
Length: 346
Type: CDS
Source: GLEAN
Position: GCSC_142:169169..169422 (+ strand)
Length: 254
>GLEAN_3417 class=GenePrediction position=GCSC_142:168746..169422 (+ strand)
ATGGGCCGCGAAGAGTCAATATCACAACCGCCGCCACCGGCGGCGCCAATGACAACGGGTGCCACGGCTACCTGGGGCAG
TCAGCATTTTGACCGGGCGCCAACAGCCCAAGAGTTGCGAGCGCTGCAGAATACAGGCGCATCGGGAACACAGACACAGA
CGACGCCAAAGGCACCGAGTGAACAAAACCAGCAGGAACAGATAGCTATCTCTGTCTCAGAAGCCGTCAAGACGATCAAG
CCAGCAGACTTTCTGCAAGTGTACCAATATCCATGCGCGCGGCAGGGCTTCATGACGGGGATAGGTGGCGGTGCGGTTGT
TGGAATGCTGCGGTATATTTTGGGAGGTAAGACTCTGGCCATACCACATACTGGGCCTCACTATCGTGTGCTCCTTGTTG
ACTTCACCTCTCCCTGCTTTCAGCAAACATCCCCAAGGCGACAAACTGGGCAGTTGGCATGTTCGCCCTCGGTGGTATCG
TCTCCTTCGAGGTATGCCAGGCCTTTCGGCGGGCCGAGCGGGCTAAGATGCAGCGTGTTGTGGAAGTGTATGACCGGAAG
CAGGCAGAGCTCCGACACCGGGAAGAAGAGAAGAAGCGGCGACAGCAGAAAGAACAGCGAGAACGGGAAGAGCGTGAAGC
GGCCGAGCGGGCAAAACAGTGGTGGAAGGTTTGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62