GenePrediction:GLEAN_3418 Details

Name: GLEAN_3418
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_142:177055..177883 (+ strand)
Length: 829
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_142:177055..177121 (+ strand)
Length: 67
Type: CDS
Source: GLEAN
Position: GCSC_142:177222..177629 (+ strand)
Length: 408
Type: CDS
Source: GLEAN
Position: GCSC_142:177819..177883 (+ strand)
Length: 65
>GLEAN_3418 class=GenePrediction position=GCSC_142:177055..177883 (+ strand)
ATGTCATTCCGTGGTGGTCCCCCGCGTGGGCGTGGCGGTTTCGGTGGTGGTTTCGGTGGCCGAGGCGGTAGGTTTCTTCC
TAAGTTCGGGACTTGAGACTTCGGCCTCTTCCCATACAGCTTTTGAGGCTGGAGGCCCAGAATATCGCTGACGCTCCTCT
TCCCTAGGTCGTGGTGGCTTTGCCCCGCGCGACATGGGTCCGCCAGCGTCCGTCGTCGAGATGGGCTCTTTCATGCACGC
CTGCGAGGGTGAGATGGTCTGCAAGAGCGTCAACGCTGCCAAGATCCCCCAGTTCAACGCCTTTGTCTTCCTCGAAAACA
AGACAAACATCGGCAAGGTGGACGAGATTCTCGGTCCTATCAACCAGGTCTACTTCACCATCAAGCCTTCTGAGGGTATC
CAGGCCACCAGCTTCAAGTCTGGCGACCGTTTCTATCTGTCCAGCGACAAGCTTCTGCCTTTTGAGCGCTTCATGCCGAA
GCCCAAGCCCCCACCGGGTACCGAGGTCAAGAAGGTTCGGAAGCCGGGCTTTGCTGCAGGTGGCCGTGGTGGCTTCAGCG
GCGGCCGGGGCCGGGGTGCACCGCGTGGTCGTGGAGGCCCGGGAGGCTTTCGGGGAGGCAGCCGTGGCGGCAGCGGTGGT
GGCTTCCGGGGAGGCAGTCGTGGCGGTCCCGGCGGTGGTCGGGGATTCTCTGGTGGCCGTGGCGGTGGTGGAGGCCGCGG
TGGTCGGGGCAGCTTCCGTGGCGGCTACTAAACTCAACACGCAGAACTTCCTCCACACTCCGAGCTGCTTCGCCCTGTTC
TTCTCAATGTTTTCGAGCGATGCTTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62