GenePrediction:GLEAN_341 Details

Name: GLEAN_341
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1158251..1159047 (+ strand)
Length: 797
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1158251..1158315 (+ strand)
Length: 65
Type: CDS
Source: GLEAN
Position: GCSC_167:1158472..1158497 (+ strand)
Length: 26
Type: CDS
Source: GLEAN
Position: GCSC_167:1158738..1158921 (+ strand)
Length: 184
Type: CDS
Source: GLEAN
Position: GCSC_167:1158990..1159047 (+ strand)
Length: 58
>GLEAN_341 class=GenePrediction position=GCSC_167:1158251..1159047 (+ strand)
ATGCGTCCGTCTCAGGCTCTCCGCAGTGGCGGCGGTGGCGACACCCCGCTAGGCAAATACAACCAGTACGAACGACCCTT
CCGTTACGCCGTGATTTTGCGCTGTTTTCTATCTGTGTCGAATGCATTGCGCAGAAGGAGGCAATGCGTTCGGCTGGCAC
CAGACCGCAGAATTGAGCCGACTTGAGGGACTTTGCTGACACGTTTCCTCCTCGTCTACAGCTACATTGGCGACTGGGGT
AGCATGGGTGAGTAACGACTGTACAATTGCCGATGACGTCCGACGTCCGAAACAAGCGAGAGCCGAGGGGAACCCGTTTC
GGGGAGGACAATGGAGCTCCAAGGACCCACTGGGAGGCGAATGCGCGCTCACCGTGATCGCCTACTACCCAGCCGGGCTA
CCCGAACGGACTACCCGATCGCTCTCTGGTGGATGCCAATGCCGCTGGGCTGGGATAGAAGAGCGGCGCACTGACAATTG
CTGGCAGGCCCGAAGATCCAGTCGCAGCGCGGCATCATCTCGTACGGCATTGCCCCCAACCGCCAGAACCCCTTTGCTCA
CGCCGGCCATGACGCCATCTTCAACTCCTGGCGGCGGGTTTCCCGGCAGGTTCTCTACTGGGCACCTACAGCCGTTGCTG
GCTACTTCATCATGTCCTGGGCATTCGAGCGGTATGTCCCTGCACACACGCCCTCACTTCTCAATCCGAGGCCGCTCTGA
CTGACGATGGCCCATACAGGAATCACTACCTCAACTCCAAGGCCGGCCGTGCTGAGACCGCCGCAAACGAGGAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62