GenePrediction:GLEAN_3422 Details

Name: GLEAN_3422
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_142:210526..215309 (+ strand)
Length: 4784
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_142:210526..211542 (+ strand)
Length: 1017
Type: CDS
Source: GLEAN
Position: GCSC_142:211610..214906 (+ strand)
Length: 3297
Type: CDS
Source: GLEAN
Position: GCSC_142:215055..215309 (+ strand)
Length: 255
>GLEAN_3422 class=GenePrediction position=GCSC_142:210526..215309 (+ strand)
ATGTCGACACGTCCAACGCGACGCGCCGCATCGCGCCGCACCGCCATCATCGAGTCGGACGATGAGATTGCCGACACAAG
TGTTCACAGTAGTGCCCAAAACGATGATGAGGAAGCATTTACGCCAGCGCCTCCGCGCAGCCCCAGACGTGCAACTACCA
GTCGGCGGAAGACCATTGCCACTGAGGAGTCTGCTTCAGCACCCAAGAAGCCTGGCCGGCCAAGAAAGGCTCGCGCATCA
GCAAGTGCCAGCACTGAACAGAGTGAGCTTATCGACCCCGATCGGACGGTGGCGTCAATGGCGTCTTCCGACGCCCCCGA
TCTAGCACCAAAGAAGACCGTGACGCGGAAGCGGAAGAGCGTGGCTTCCTCGTCCAAGTCGGTGGCGGTCAAGTCTGAGA
CGTCTGGACTGCCTGAGCTGTCGGAGCTGTCGGAGGCGCCGGTGTCTGTCCCACGTCGTCGAAAGACTGCCTCTGTCGAG
CCTGCAGACGCTACGACCATGGATGCATCCACAATGGACACGACTGCAGCCAGCGACGTGACTACCACCTCGGCACCCTT
GGTTGACATCACGGCAACAGTCGCCAACGGTCAGCAGCGGCCGGCGACGGCAACCACAGACGAGGCCGTGGCTGCTATGA
AGCCGATCCGTGCTATGGATGCGCTTCTTGAGAAGCCCATGGACATTGTTCTCAAGTCGCGCACCATGACTAATATACCA
TCGGACGAGCCTGCTGCGCCCAAGCCGCGCATTGTCATTGCGTACCTCATCCTGACTAACTTCAAGAGCTATGCCGGTCG
GCAGGAGGTCGGCCCATTTCATGCGTCCTTCTCGTCAGTTGTTGGTCCGAACGGATCGGGAAAGTCCAACGTCATCGACT
CGCTTCTGTTTGTGTTCGGCTTCCGCGCAAGCAAAATGCGCCAGGGTAAGCTGTCTGCCCTGATTCACAACTCGGCGCAA
TACCCGAATCTCGACTACTGCGAGGTTGCTGTTCACTTCCGCGAAGTGATGGATCTTGTAAGTTGCTCTAGCGTATATGT
TCTTCTCTTTCCGGGCCACAGACCTGTTGCTGATGTCTGTGTAGCCTGGTGGTGGCTCCGAGGCTATTCCCAGTTCGGAC
TTGGTTATCTCCCGCAAGGCCTTCCGCAACAACTCGAGCACGTACTACATCGACGGCAAGTCGTCGAACTTTACCACGGT
CACGACATTGCTCCGGGACCGCGGTGTCGACCTGGACCACAAGCGGTTCCTGATTCTGCAAGGCGAAGTGGAATCCATCG
CACAGATGAAGCCCAAGGCGGGCAACGAGCATGAGGATGGGCTCCTGGAATATCTCGAGGACATTATCGGCACATCCAAG
TATAAGACGCCAATTGAAGAGGCAGCCAACGAGGTCGAAACACTCAACGACATTTGCATGGAGAAGAGCGGGCGGGTGCA
GCACGTCGAGAAAGAGAAGCATAGCCTCGAAGACAAGAAGGACAAGGCGATTGCCTATGTCCGGGACGAGAACGAACTGG
CGATGAAGCAGTCGGCTCTCTACCAAATCTATATTGGCGAGTGCACAGACAATGTGGCTGTTACGAAAGAAGCGATCTCG
CAGATGCAGGCGGAACTGGACGCCGAGCTCGAAAAACATCACGGCAGCGAGCAGGAGATCAAGCAGTTGGAAAAGGCATA
CAGCAAGGGCAGCAGACAGTGCGATGCCCAAGAGAAGGAAACACAACAGCTGCTTAAGGACATGGCTAAATTCGACCAGG
AACGTGTAAAGTACGAAGAGAAGCGCAAGTTCCTGGGCGACAAGCGCAAGAAGCTTGAGAAGGCCATTGCGACTGCGGAG
AACTCTGCGGCTACGGCAGCCGAGACGGTCGAGCAGTGTACGGAGGAGATTGGGACGCGTGCCGAAGAGATGGCACAGCT
GGAAAAGCAAATCAAGGAGGAGGAGGCGGAGCTGACGAGCATCCGTGACAGCCTGAAGGGCAAGACGCAGGCATTTTCGG
ACCAGATTGCAGCGAAGCAGAAGTCGCTGGAGCCGTGGAAAGACAAGATCAACCAAAAGCAGTCGGCGATTGCGGTGGCG
GAGAGCGAGCTGGCGATCTTGCAGGAGAAGGCGACGGCCGGGGCGACGGCGCTGGAGGAAATGCAGGCGAAGATCGGCAG
CATCGAAAAGGGACGGGCGGCAAAAGCGGCGGAGCTGCAGGACTGCCAGTTGGAAAAGGGGCGTCTGGAGAAGGAGGCAA
AGAAGGTGGAGGCAGAACTGGCAAGTCTGGCGCAGCAGGAGCCCAAGATGCGAGCACAGCTGTCGAATGCGCGGCAGAAG
GCGGACGAGGCGCGTTCGAGCCTGTCGCAGACGCAGACGCAGGGCAACGTGCTGACGGCGCTCATGCGGATGCGGGAGTC
CGGCCGGATCGACGGCTTCCACGGGCGGCTGGGCAACCTGGGGACGATCGACCAGCAATACGACGTGGCGATCTCGACGG
CGTGCCCGGCGCTGGACAACTTTGTGACGGACACGGTGGAGGCGGGCCAGCAGTGCATCGAGTATCTGCGCAAGACGAAT
CTGGGCCGGGGCAACTTCATCTGCCTGGACAAGCTGCGGGTGCGGGACATGGCGGCGATGCAGACACCGGAGAAGGCGCC
GCGGCTGTTCGACCTGATCCGAGCGAAAGACGAGCGATTCCGGCCGGCGTTCTACCACGCGCTGCAGGACACGCTGGTGG
CCAAGGACCTGGCGCAGGCCAACCGGATAGCGTACGGGGCCAAGCGGTGGCGGGTGGTGACGCTGGACGGCGAGTTGATC
GACAAGTCGGGCACGATGTCCGGCGGCGGGACGACGACGAAGAAGGGTCTGATGTCTTCGAAGCTGGTGGCGGACACGTC
GAAGGAGCAGGTGGCGCGGCTGGAGGTGGACCGGGACGGACTAGAGCAGCGGTTCGCGGAGTTCCAGGAGCGGCAACGGG
AGCTGGAGGGCCGGCTGCGATTTCTGGGGGAGCAAATTCCGCAGATGGAGACGACGATGCAGAAGCTCAGCCTGGAGCTG
GACAGCGCGGCACGGAACCTGGCGGACGCGCAGCGGCGAATGAAGGAGCTCGGGCGGGAGCAGCAGCCATCGTCGGCGGG
ACATGACAGCAAGCGGGCGCTGGCGCTGGAGAAGGAGGTCGGGCGGCTGGGGGCGGAGTCAGAGCAGCTGCACGGCGAGA
TGGCGAGTGTGGAGGCGGAGATTCAGCGGCTGCAGGACAAGATCATGGAGGTGGGCGGCGAGAAGTTGAGGGCACAGCGG
ACGATGATCGAGGCACTCAAGGAAGAGCTGGCGAGCCACAACGAGGAGACGTCGAACGCGGAGGTACGACGGGCGAAGGC
GGAGAAGCAGATGGCAAAGCTGGAGAAAGACCGGGCAAAGGCAGGCAGAGAGCTGGAGGCAGCGCAGCAAGAGCTGGAAC
AACTGGAAGCGGAGATCCAAAATCAGGGCGACAAGGCGGAGTCGCTACAGACGGCGGCGGAGGCGGCGAGGGAGAGCCTG
GTGGTGAAGAAGCAGGTGTTGGCCGAGGTGAAGGCGGAGCTGGACGAGAAGATGGCAGAGCTGAACACGACGCGCGGAAT
GGAGATCGACATGCGCAACAAGCTGGAGGAGAACCAGAAGGTGCTGGTGGAGAACGAGAAGCAGCTGCGGTACTGGGAGA
ACAAGCTGTCGAAGCTGCGACTGCAGGACATCCACGACCTGGAGCGAGCCAAGGTGAAGGTGGAGGGAGGAGAGGGAGGG
GATGAGGGAGCGGGGGAGGTGGCGAGCGAGCCAGCTGACAAGGACCAGCCGATCAAGAGCGAAGGGACAGGTGACAGTGC
GGGAACACCACCACTGGAACTCACACGGTACAGCCCAGACGAGCTGGCAGGCATGCAGAAGCAGGTGCTGCAGGGGGAGA
TTGCGGCGCTGGAGGAGAAGACGCAGAACGCGAGCGTGGACCTGGGCGTGTTGGCCGAATACCGACGGCGGGTGGAGGAG
CACGCGGCGCGGTCGTCGGACCTGGCGTCGGCGGTAGGCCAGCGAGATACGGCGAAACGACGATGCGACGACCTCCGACG
ACTCCGGCTCGAGGGCTTCATGGAAGGCTTCGGGGTGATCTCACTGCGACTCAAGGAAATGTACCAGATGATCACGATGG
GCGGCAACGCGGAGCTGGAACTGGTCGACTCGCTGGACCCGTTCTCGGAGGGCATCCTGTTCAGCGTGATGCCACCGAAG
AAGTCGTGGAAGAATATCAGCAACCTGTCGGGTGGCGAGAAGACGCTGAGCAGCCTGGCGCTGGTGTTTGCGCTGCACCA
CTACAAGCCGACGCCGCTGTACGTGATGGACGAGATCGATGCGGCCCTAGACTTTCGAAATGTGAGTATTTTTTTCCATT
TCTTCTTTCTTCTTTCTTCTTTCTTCTTTCTTTCTTTCTTCTTTCTTCTTTCTTCTTTCTTCTTTCTTTCTTTCTTCTTT
CTTCTTTCTTTTTACTTTCTTTCTTCCCTTCTTCTAACTCTTCCATCAGGTCTCCATCGTGGCCAACTACATCAAGGAGC
GGACCAAGAACGCCCAGTTCATTGTCATCTCGCTGCGCAACAACATGTTTGAGCTGGCTGCCCGGCTGGTCGGCGTCTAC
AAGGTCAACCACATGACGAAGAGCGTGACGATTGAGAACCGCGACTACATCACCCGGCTGCCGGTACGGCCAGGCCCGGT
CGGCGTCCAGACGCCTGCACGGCCAGCAGTCCCGCAGATCAGCCAACTGGCGACGCCGCCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62