GenePrediction:GLEAN_3424 Details

Name: GLEAN_3424
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_142:224605..226362 (+ strand)
Length: 1758
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_142:224605..224648 (+ strand)
Length: 44
Type: CDS
Source: GLEAN
Position: GCSC_142:224735..224807 (+ strand)
Length: 73
Type: CDS
Source: GLEAN
Position: GCSC_142:224887..226362 (+ strand)
Length: 1476
>GLEAN_3424 class=GenePrediction position=GCSC_142:224605..226362 (+ strand)
ATGGCGGATGGTCTCGTCGAAAAGTTGAAGTCGACTACGCTGAAGTGAGCTTCTAATGGCCCATTTTCCTATCGGCTCGA
AAACCTACCAAACTTTGTTGCAGATCTTCTAACTGAATAATTGCAAGCAGTGATGACAGAAAATCAGACGACTGGAAGAG
TACACTCAACATCCCCACAAAAGACAGCCGACAACAGACCGAGGTGAGCTTTTCCGTGGGTTATACCACACTAGATGTCG
ATCTGGTAACCTGTAAGCGCAATATTGACCGTCTCGTGCTAGGATGTGACAAACACAAAGGGCCTTGAATTCGAGGAATT
CGGTCTTAAGCGAGACCTGCTTATGGGAATTTTTGAGGCTGGATTTGAGAAGCCATCACCCATCCAAGAAGAGAGCATCC
CCGTTGCCCTGACTGGCCGTGACATTCTTGCACGAGCAAAGAATGGAACGGGAAAAACTGCCGCCTTCGTTATCCCTGCC
CTCGAAAAGATCAACCCAAAGGTCTCCAAGATCCAATGCCTGATTCTCGTTCCTACCCGGGAGCTTGCCATGCAGACCTC
ACAGGTCTGCAAGTCGCTAGGAAAGCATCTTAATATCAACGTTATGGTAACGACAGGCGGAACAGGGCTTCGTGATGATA
TTGTTCGGCTCCAGGAGGCCGTCCATATCGTGGTCGGCACCCCCGGCCGAATTCTTGATCTAGCAAGCAAGAACGTGGCT
GACCTCAGCGAGTGCCCCATGTTTATCATGGACGAGGCGGATAAGCTTTTGTCGGCGGAATTTACACCAGTCATAGAACA
GCTGCTGCAGTTCCATCCCAAAGACCGCCAGGTCATGCTATTCTCAGCAACCTTCCCTCTCTCCGTCAAAGACTTCTCGG
ATAAAAACATGGTCAGCCCCTACGAAATCAACCTCATGGACGAGCTCACTCTCCGGGGCATAACCCAGTACTATGCATTC
GTGGAGGAGCGCCAAAAAGTCCACTGCTTGAACACCCTTTTTTCGAAACTTCAAATCAACCAATCAATTATATTTTGCAA
CTCCACGAATCGTGTCGAATTGCTGGCGAAGAAAATTACCGAGCTCGGCTACTCTTGCTTCTATAGCCACGCTAAAATGG
CTCAGCAGGCACGAAACCGTGTTTTTCACGATTTTCGCAACGGAGTTTGCCGTAACCTCGTCTGCTCCGACCTTCTCACA
CGAGGTATCGACATACAAGCTGTCAATGTTGTTATCAATTTCGACTTTCCCAAAAATGCAGAGACTTACTTGCATCGCAT
TGGTCGCAGCGGTCGCTATGGCCATCTTGGATTGGCTATCAATCTGATCAATTGGGACGACCGCCTAAACCTCTACAACA
TCGAGAGAGACCTGGGGACGGAGATCCAACCTATCCCGGCCACCATCGACAAAAGCCTTTATGTGTACGAGAATCCGGAG
AGTATTCCTCGGCCTATCGCAACGCTGGCAAAACCGGCGTCTTTCCCGGCGGCATCTGGTTCCGGCTCCGTCGGTCAACT
CCAGACAAATTCGCAATCAAGGGCAAGTCAAGCCCAGCCGACTTTGCCCCAGGCACAGGGTGATTGGCAGCAAGGCGGAT
TCAGCGGCAGTACTCAACGGGGAGGTTATCAGGCAAGAGGCCAATCGTCTGGCTCGAGAGGTGGTCGCGGCCGTAACGGT
TATCACGGCGGCAGAGGTCACTATGGTGGCCGTGGTGGCCGTGGCGGACAGGGAGCTCCACCAGCTCAACAAGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62