GenePrediction:GLEAN_3426 Details

Name: GLEAN_3426
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_142:253497..254920 (+ strand)
Length: 1424
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_142:253497..253655 (+ strand)
Length: 159
Type: CDS
Source: GLEAN
Position: GCSC_142:253733..254920 (+ strand)
Length: 1188
>GLEAN_3426 class=GenePrediction position=GCSC_142:253497..254920 (+ strand)
ATGGATGGTCTTTCAGCAGACGAAGACTTCTATGCCATTCTCGAAATCGCGACAACAGCAGATAGCTCGGCTATATCAGC
GAGCTACCGGCGCTTGGCAAGACTACGACACCCGGACAAGAGCCCAGGAAATCCTCAGGCTACTGCTGCATTTCAGAAGG
TCCCCCCCCCTTCTCCCCTTCTTTCTTTTCGAGACTTTATTAACTCTCCTTTCTAATCGTACCTAACTGCGTACAGCTCC
ACGAAGCATACTCCGTTTTGATAGACGCCAAGAGCCGGGCAGACTACGATTACAACCACCTACGCCCATCGTGCAGAACT
AAGAGCCCCAAAAACAAGAAGAGATTTAGGTACAAGTTCTACTCCTTCAATATTAGTGAGAAGTGGGAACGCCGATCAAG
CTCGAACCATGACGGCCCTTCTTCGCCGCCGCCAATGGTAGACTTGCTAGCTCATGGTATTCAAAACATCCGCAGACAAG
TCAACGAGGACGATACCACCCTAGTCAGGGAAAAGGCGATCGCGAAAGATCTTGTAGCTCGGATAGATGGTGTATGGAGG
CAAATCCATGGGACCGAGGAATCGCTAAAACAAATGGACGACGAGATTTTGTTTCTTTCAAACAAAAACAAGCTTCTGGG
GTCGGGTTACTGTAAACTCGATGACCTGGCAACAACGGGAAGTGGTTCATGGGCAGAGGGGCGCAAAGTCGTGCTGTTGG
AAAAGCGGCAATGTTTGCAAAGTGTGATGGTGCAGCTTCGCCAACAACTGGAGACATTTGCAGCTTTGTTAAGAGCTCAT
ATCACCAAGTCCAAGGAATTGATATCCAACAAACTTGAAAAAGAGGAAAAGCTACACGCTCTTTGCAAAGCTTGGCGAGC
ACGAGAGTTTCACGGAGGTGAAGAAAGTGCTGAGTCGGATAGTTGGGGCGGATGGGACGGCTGGTGCTGCTGGGATCGCC
ATGAAACAGATACCAGCTGTGAGGAAGACAAACGTGAAGAACAAAAGAAATGGTGGGAGGAGGAGGAGGTAGAGGGATGC
AGCAGCTGGGAGTCTTGGGAATCTCCTGATATAAGTGCGGCGGGAGACGACTGCACTAATGGAGCTGAAACGACCGAACC
CGATCTGATCGATCTCCAGGAAATGAACCATGAGAATAGTGCTGGCTTCCAGGTTGAGAGCAATCAATTTGGAAGCATGG
AAGATGAAGAAGATTCGGTTTCGTCGGCAGGGCCCATATGGACAGATGAGTTTGATGTGGACCTTGTGAAGCGAGATGGG
AACAACAGTGTGCCTAAAGAAGGCGGTTCTCGACACGCTTTGGAAAATGCTTGGTGGCCTGAGGCGGACAAAGATAGAGA
AACTGCTCGGGGCTGGGAGATATATGAAGACGAACGACGACAGGCTTCGTGGCAGGAGTGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62