GenePrediction:GLEAN_3427 Details

Name: GLEAN_3427
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_142:257080..258120 (+ strand)
Length: 1041
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_142:257080..257163 (+ strand)
Length: 84
Type: CDS
Source: GLEAN
Position: GCSC_142:257224..258120 (+ strand)
Length: 897
>GLEAN_3427 class=GenePrediction position=GCSC_142:257080..258120 (+ strand)
ATGGCCACTTCCATGGCGAAGTCTAAATTCCTGAACAACCAGGAGAACCTAGGCATCGTCGCTGTAGGCTTCTCTGGGGG
CCAGGTAAGCGGACATAAAAGATTATGTTCAATTTGACTGAATGTGTTGTTAATGATTGCGCAGTGCAAGCCAGGTGTCG
ATGCCGCCCCCTCAGCCTTGATCGAGTCAGGCCTCCTAACCCAGCTGCGCGATGAGCTCGGCTATAAGTTACACGGCGAT
GACACGGTTCACCTCTATTCAGATCTCGTACCGGAGTCTGACCCGGATTACCGTGGCATGAAAAACCCACGCGCTGTCTC
TGAAGTCACACGCCGTATCGCCGACCAGGTCTACGAGCATTCCCGCCAAGGCCGATTGACTCTAACCCTCGGTGGCGACC
ATAGCATCGCTATAGGCACCGTGGGCGGTACTGCTAAGGCTACCCGCGAGCGCCTGGGCCGTGAGATCGCCGTCATCTGG
GTCGACGCCCATGCTGACATCAACACCCCCGAATCCAGCGACAGTGGCAATATACATGGCATGCCCGTCGCTTTTTTGAC
CGGGATAGCTGAGGACAAAAACGACGACTATTTTGGCTGGCTAAGGCCAGAGAACCGCATTAATGTCAGCAAGTTGGTGT
ATATCGGCTTGCGCGATGTTGATGCTCCTGAGAAACGCATCCTGCGGGAACACAGCATCCGCGCCTTCAGCATGTTCGAT
ATTGACCGTTACGGCATCGGCCGCGTCATGGAGATGGCCCTCGCTCATATTGGCGCGGACACGCCCATTCATCTCTCGTT
TGACGTCGATGCTCTCGACCCAATGTGGGCACCGTCGACTGGTACGCCTGTGCGCGGTGGCCTTACGTTACGCGAGGGTG
ACTACATTTGCGAATGCATACACGAGACTGGCAGCCTTATTGCCGTCGATCTCGTGGAGGTCAACCCCAGCTTAGCGCCA
GATGTCGACCTAGGTGCACATGAAACTGTTCGTGCGGGCTGCTCTATTGTGCGATGTGCTCTCGGTGAGAGCTTGTTGTA
A

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62