GenePrediction:GLEAN_3428 Details

Name: GLEAN_3428
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_142:264956..266441 (+ strand)
Length: 1486
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_142:264956..265602 (+ strand)
Length: 647
Type: CDS
Source: GLEAN
Position: GCSC_142:265672..266086 (+ strand)
Length: 415
Type: CDS
Source: GLEAN
Position: GCSC_142:266220..266441 (+ strand)
Length: 222
>GLEAN_3428 class=GenePrediction position=GCSC_142:264956..266441 (+ strand)
ATGTCCAACACCGATTTTCTAGGCAGGGCTATCGAACAAGTGCGTAAGGCAATTGAGGCTGACAATTCTGCTGAATATGA
AAAGGCGTATCAGCTCTACTACTCCGCCTTGGAAATGTTCATGTTAGCGCTCAAATGGGAGAAGAACCCAAGGTCAAAGG
AGATGATTCGCCAGAAGACTACCGAATACATGGACCGTGCAGAAAAATTGAAATCACACCTGTCTGATGTCGATGCCAAG
CGAAAAAAACCGGGCATGGTCGGTGCAAACGGAGCTTCGACGGCCGGTACTGGCAAAGGCAAACAGGGCGGAGAGGACGC
TGGCGGCGACGGCATTGACGAGGACAGCAAAAAGCTACGCAGTGCATTGGCTGGAGCTATCCTACAAGACCGCCCAAACG
TGAAATGGGATGACGTGGCCGGTCTGGAGGCTGCTAAGGAAGCGCTGAAGGAGGCTGTTCTGCTGCCTATCAAATTCCCA
CATCTCTTCCAGGGCAAGCGGCAACCATGGAAAGGCATATTGCTATATGGTCCACCGGGGACAGGCAAAAGCTATCTTGC
CAAGGCCGTAGCTACGGAGGCCAAGAGTACGTTCTTCAGCGTCAGTAGCTCTGACCTAGTCAGCAAATGGATGGGCGAGA
GTGAAAGGTTCGCAGTCTCACCGCATATCAGTCTTGCACCTTGTTCGTTATAACTAACTTTGACACTTACTTGAAGGTTA
GTCAAGCAGCTTTTCAACATGGCCCGCGAAAATAAACCGTCTATTATATTTATCGATGAAGTCGATGCGCTATGTGGCCC
TCGTGGCGAGGGCGAGTCCGAAGCGTCACGGCGCATTAAGACCGAGATGCTCGTCCAGATGGACGGCGTCGGCAAAGATA
GCACGGGTGTGCTCGTCCTCGGTGCTACCAACATTCCCTGGCAGCTCGATGCCGCGATTCGGCGTCGTTTCCAACGTCGA
GTTCATATCAGCTTGCCCGACCTTGCTGCCCGCACAACCATGTTCAAGCTTGCTGTCGGCGAGACACCTACTACTCTGAA
ATCCAACGACTACCGCGAACTAGCAAAGCTCGCAGAAGGCTACTCTGGCTCTGATATCAGTACCGTCGTCCAGGATGCAC
TTATGCAGCCTGTTAGAAAAATTCAACAGGCGACACATTTCCACCCGGTAAACAAACTCCTCCCATTCGATGGCCTGCCC
TGCCTCAAACGCCACGCCAGTGGCACGCGTGCGGCACATCTGAAACTAATTGATTCTGCTTCAGGTTATGCTCGATGGCA
AGCGGAAGTTGACTCCCTGTTCACCAGGGGAGCCAGATGCCGACGAGATGACTTGGGATGATATCGGACAGGACGAATTA
CTTGAGCCGACAGTAGATTTAAAGGACTTTATAAAGGCTATCAAAGCCAGCAGGCCAACAGTATCCAAAGAAGACTTAAA
TCGAAACGCAGAATGGACAAACGAGTTTGGCAGCGAGGGCGCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62