GenePrediction:GLEAN_342 Details

Name: GLEAN_342
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1160652..1161850 (+ strand)
Length: 1199
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1160652..1160938 (+ strand)
Length: 287
Type: CDS
Source: GLEAN
Position: GCSC_167:1161035..1161119 (+ strand)
Length: 85
Type: CDS
Source: GLEAN
Position: GCSC_167:1161229..1161293 (+ strand)
Length: 65
Type: CDS
Source: GLEAN
Position: GCSC_167:1161361..1161569 (+ strand)
Length: 209
Type: CDS
Source: GLEAN
Position: GCSC_167:1161634..1161777 (+ strand)
Length: 144
Type: CDS
Source: GLEAN
Position: GCSC_167:1161834..1161850 (+ strand)
Length: 17
>GLEAN_342 class=GenePrediction position=GCSC_167:1160652..1161850 (+ strand)
ATGGCATCTTCTGTCACGATGGTGAACTCGGCGACGGTGACGACGGCACCTGGTCTGTACACGCAGACATCGATGGACTC
GCTGAACTCCCATCCGGCGACGGCCGCGCAGGCGCGGGCCTTCACGGCCCCGACGTCACTTTCGTTTCCTGGAGGCACGG
ACACCATGACGCCACCGTCTGAAAAAGATGGGAACGCGCCTAACGGCATAAAGGCGGCGTCTACGAACCCAGCGTCAGCA
CCGGGAACGGTTGCTACCACTGAAAACAAGCGGCTGCGACGGTGGGAGTGAGCGGCATCGTGCCGACGTTGCAGTGAGTG
TCTTGCCCTCCATTGAGTCTCATTCGTAAAGAACACTTGTTCATAATTTTTTTTCGTAAAAAGGAATATTGTCGCGACTG
TCAACCTCGACTGCCGGCTTGACCTGAAGACCATCGCGCTGCATGCTCGCAATGCAGAGTACAATCCGGTTCGTACACAC
GGTCCCCCTTCATCCTTCTCAGTTGAGCGTTGAGAGGGATACTGTGGGTGATACATGTGCAAATCGTATCGCTGACCCGG
GTTCTGTCACTGCATAGAAACGTTTTGCTGCCGTCATCATGCGTATTCGCGATCCGAAGACGACAGCTTTGATCTTTGCA
TCGTAAGTATTGCAAGCCTCTTCACTATCCACACTTTTCCAGAGGATGTATACCAACATATGTCCGCAGTGGCAAAATGG
TTGTTACTGGTGCCAAGTCTGAGGACGACTCGAAGCTGGCCTCCCGCAAGTACGCTCGTATCATCCAGAAGCTGGGCTTC
AATGCGAAGTTCACCGACTTCAAGATCCAGAACATTGTGGGCAGCTGCGATATCAAGTTCCCTATCCGCCTTGAGGGCCT
GGCCTCTCGTCACCACAACTTCAGCTCCTACGAACCTGGTATGCTCTTGTCTTCTCGCTGCTTCCTCATGGCAACAAATT
TCCATACTAACAGTTACTTCAGAACTGTTCCCCGGTCTTATCTACCGCATGATCAAGCCCAAGATCGTGCTACTCATCTT
CGTCAGCGGGAAGATTGTTCTCACAGGCGCTAAAGTCCGTGAGGAAATCTACACTGCTTTCGAAATGATTTACCCTGTCC
TTCAAGGTAAGCACCCACAACTTCGCATACGTTCAAACAACATGGCAGCTAACTCCACCCAGACTTCCGCAAGGTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62