GenePrediction:GLEAN_3430 Details

Name: GLEAN_3430
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_142:271361..272075 (+ strand)
Length: 715
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_142:271361..271383 (+ strand)
Length: 23
Type: CDS
Source: GLEAN
Position: GCSC_142:271461..271588 (+ strand)
Length: 128
Type: CDS
Source: GLEAN
Position: GCSC_142:271665..271767 (+ strand)
Length: 103
Type: CDS
Source: GLEAN
Position: GCSC_142:271973..272075 (+ strand)
Length: 103
>GLEAN_3430 class=GenePrediction position=GCSC_142:271361..272075 (+ strand)
ATGGTCAAAAAGAGAAAGAACAAGTATGCCTTCTTTTGCCGAGACACATCTACAAGAATGACATATGACAGTGGCCAATA
CTGACACGTCTTCCTTACAGCGGCCGCAACAAGAAGGGTCGCGGCCACGTCAAGCCTATCCGCTGTTCAAACTGCTCGCG
ATGCACACCCAAGGATAAGGCCATCAAGCGGTTTACCATCCGCAACATGGTTGAATCTGCTGCTATCCGTATGTTCCGGA
ATTTTTAACAGCTTCCCGCCGGGTGGCTAGTCAGGACTCGCGGAAGACTAACAAGTTGGGATAGGTGATATCTCGGACGC
GTCCGTTTTTGCAGACTATACCGTCCCCAAGATGTACCTCAAGCTGCAGTACTGTGTGTCTTGTGCCATTCATGGCAAGA
TCGTTCGGTACGTTTGCCCTCGGGAGAGGCAACCGTGCTGGGGTTGTCGAGAGGCAACCTCGCACGGGCGGCTGAGAAGA
ACCTTGGCGACCGAAGTCCTCCCTGGAAGCATATGTGCTGGGCTCCCATTACTGGCGCATTTGTCTCTCCTATCTATGGT
CTCGTTCATAGTTGAAGGTGAAAGCGAGCCAGATTTGCTAATTAAATTACAGTGTACGCTCGCGCGTTGGCCGTCGCAAC
CGTGCGCCTCCGCCGCGCGTCCGATACAACAAGGATGGCAAGAAGGTCACGCCCACTCAGGCCAAGACAGCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62