GenePrediction:GLEAN_3431 Details

Name: GLEAN_3431
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_142:272580..274564 (+ strand)
Length: 1985
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_142:272580..272717 (+ strand)
Length: 138
Type: CDS
Source: GLEAN
Position: GCSC_142:272791..272941 (+ strand)
Length: 151
Type: CDS
Source: GLEAN
Position: GCSC_142:273028..273476 (+ strand)
Length: 449
Type: CDS
Source: GLEAN
Position: GCSC_142:273545..273744 (+ strand)
Length: 200
Type: CDS
Source: GLEAN
Position: GCSC_142:273847..274207 (+ strand)
Length: 361
Type: CDS
Source: GLEAN
Position: GCSC_142:274265..274564 (+ strand)
Length: 300
>GLEAN_3431 class=GenePrediction position=GCSC_142:272580..274564 (+ strand)
ATGATGGGGTTGTCGCCATCTATGAGGTCAATTTCTATCCTCGTCTTATTGATAAATTTACCAACACACAAAATGGAATT
TCAGGTTGTGCACCTTACTTACTGGCTTAAGGCAATATTTGCCATGCTATCAACATACGTACGCTTATATACATGATATC
AGCGCCAAGAACACCATCCGTGAGCTCCGCGTACTGATACATGTTAAACAGGTCGTCAGCCTAGTGTTTTACAGAGTCTT
TTTTCACCCGCTGGCGAATTACCCCGGGCCTTTTTTGGCCAAAGTGTCGAATGCATATATGCTATACTACGCCTGGAAAG
GCGAGCGGCATATTGAGTTTTGGAGACTACACGAGAAATATGGTTAGTAGCGATAGGTTGGAGAAAGACCCGTCAATGGA
AGCCATCAAATTTATCGACCCGATCTAATTGATGCTGTGCATCGATAGGTAACGCTGTGCGGTTCGCCCCCAATAGCCTC
TCATTCAACAGTAATTCTGCGCTCAAGGAGATATATGGCTTCCGAGCCAATGTGCGCAAATCAGAATTCTACGACGCATT
CGTTCATCCGGCACCCAACACCCATAACACTCGTGAAAAAGATATTCATGCTCGCAAGAGAAGGGTTCTGTCACAGGCGT
TCTCGGACGGGGCAATAAAAGAAATGGAGCGGTACATTCTTGCCAACATACGCATATTTTGTGATGAGATCGGATGTGAC
GCGAGCCACAGCTTTGCGAGCAGTCAGGAGTGGTCTTCCCCGAGAAACATGGCCGATTGGTGTAACTACCTCGCCATGGA
CATTCTGGGCGACTTGTGTTTTGGAAAAGCGTTTCGCATGCTGGAGTGTCCATACGCCATCAACCTGGTTGGTATCGCTG
CACAGAGACATCTTCTTGTATGTGCAATATGACCCATTACTTGTGCAATTTGACCCATTACTTGAGTAATACTAATAGAA
CCAAGTGTGGAACTATGCCGATCATTGACAGGCTCGGCCTCGACAAAGTCCTCTTCCACAGAATCTCAGAAGGAAGGGCC
AAATATATGGAATATAGTCGCGCCCAGCTCGGCATACGGACAAAGCTTGGAGACGAGGCCGACCGCCGTGACTTTTTCTA
CCACCTGCTTAAAAGCCCGAGATCCCGAGACGGGGGCCGGGTTCAGCATGCCCGAACTGTGGGGAGAGTCAAATTTGCTG
TACGTCAGGTCATGGAAGGTCCAGAGTAAACTGACAGGCGGGAAGTGTTAACAAACATGAGCGTCAGTATCATTGCTGGT
TCAGACACGACTTCGACGGCGATGGCAGCCACATTGTTTTATCTGACCCGAAATACAATGGTATTGGCCCGCGTGACTAG
GGAAGTGCGCAGTGTCTTTTCTACTGTGGAGGACATTCGCCAAGGCTCTCAGCTTACAGGCTGCACTTACCTTCGTGCCT
GCATTGACGAGGCTATGCGACTTTCACCATCTGTTGGCGGTCTGCTACCACGCGAGGTGCTCGCAGGTGGCATCCAGATC
GGCACCGACCTGATTCCTGAGGGCACAGTAATCGGCACACCACACTATGCAATTCACCACAATACTGAATACTTTCCTGA
GCCATTTTCTTATCTTCCAGAACGATGGATAAAAAACGCGAGCATTCTCCGGCCGATATCTCTTAAGAATCATTTGGGTT
GCAAGGCTAAAGTTTCAACCGAAGAGGAGGTCAGCCGTGCCCAGTCAGCGTTTTGTCCGTTTAGCATCGGCCCCCGTGGC
TGTATAGGTAAGGGGCTAGCATACGTCGAGATGACCACTGCGTTAGCCCGGGTACTGTTCCTTTATGATATGCAACGTGC
CGTTGGGATCGTGGACCCAGGCGAGGGCAACCCACATGCGGCATGGGGACGCCACCGGCCGGAAGAGTTTCAGCTAGTGG
ATACATTTACTAGCCTGAAGAATGGGCCTATGATCGAATTTCGTGCCCGGATGCATACATCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62