GenePrediction:GLEAN_3442 Details

Name: GLEAN_3442
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:43917..46878 (+ strand)
Length: 2962
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:43917..44050 (+ strand)
Length: 134
Type: CDS
Source: GLEAN
Position: GCSC_156:44124..46425 (+ strand)
Length: 2302
Type: CDS
Source: GLEAN
Position: GCSC_156:46488..46634 (+ strand)
Length: 147
Type: CDS
Source: GLEAN
Position: GCSC_156:46714..46878 (+ strand)
Length: 165
>GLEAN_3442 class=GenePrediction position=GCSC_156:43917..46878 (+ strand)
ATGGCGGCACCCATAACTCCTGAAGACCAGGCGAGGCTCCTTGAGGATGCTCTCATCGCCGTGCGGCAACAGACGGTTTT
GATGCGAAAGTGTTTGGACACACCTGGAAAACTAATGGACGCCCTGAAATGCTGGTGCGTCGATAACCTATGCTCCCAGT
GACTCTGGTAGTTTGTCGACACAATTATCCTCTAACCCACGACACAGCTCAACACTCGTCTCTGAGCTGCGGACGAGCAG
CCTCGGCCCCAAGCAGTACTACGAGCTCTACATGTCCGTTTTCGATGCCCTGAGATACCTCTCCGTTCACCTGCGCGAGA
ACCACCCGGTCAATCACCTGGCCGATCTTTACGAACTCGTGCAGTATGCAGGAAACATCATCCCCCGCCTCTATCTAATG
GTCACGGTCGGCACAGCCTACATGAGCATCGAGGGCGCGCCGGTAAAGGAGCTGATGAAAGACATGATGGACATGAGTCG
AGGCGTCCAGCATCCGGTACGGGGCCTCTTCCTGCGATACTACCTTTCGGGCCAAGCGCGCGACTCCCTGCCGATGAGCG
ACGGCGATGGCCCGGAGGGAAACTTGCAGGACTCTATCAGCTTCATCCTGACCAACTTTGTCGAGATGAACAAGCTGTGG
GTGCGCTTGCAACACCAGGGTCATTCGCGCGAGCGCGAGCAGCGCACACAAGAGCGCAAAGAGCTGCAGCTTCTTGTCGG
CACCAACATTGAGCGGCTCAGCCAGCTGGTCGACCTGGAGACATACAAGAACACCATTTTGGCCCCATTGCTGGAGCAGG
TGGTGCAGTGCCGAGACGTCTTGGCCCAGGAGTACCTCCTGGAGGTCATCACCCAGGTTTTCCCCGACGAGTTCCACCTG
CATACACTCGACCAGTTTCTGGCTGCCGTCTCCAAGCTTAACCCTCACGTCAATGTCAAGGCTATCGTGGTCGGCCTGAT
GAACCGCCTCTCCGACTATGCTGAGCGGGAAGCCCAGAGCCGTCCGAACGACAACCGCGAGAAGATGGAAGAGGACGCTC
TTGCGGCCCTGCTGGAGAAAACCACGCTTAGCGATACCTCCGTCGTGGAGGCTGCCCCTGCCGAACCCACTCGCTCAGAA
GCGTCGAACTCTGCTCTCTTCGGCACAGAGGATAGTGCTGGTGCTGAGGACACAGACAAAGTCGTGAAGCCCGAAGGCGA
CGATAGTTTGTCAACTGCAGAGACGTTCGAAACCACCCCTTCTACCGCCGAGACAGACGTTACTGCTGTTAACGGGAGCG
AGGCCGACGAAGTGGCAGATGAACATACCGAGCCAGAGAGGACCAGTGGCGGAAACGGAGACGCTGCTGAAGCTATTGCC
ACCAATGTTCATCTGTACGAAGTGTTCTTCGGGCAGGTGAAGTCGCTCGTCTATGCCCAACACCTGCCGATCCACGATTC
TATCGCATTGCTGGTTTCATTGACAAACCTGGCTCTCAACATCTATCCTGATCGCTTGGACTACGTCGACCAGATCTTGT
CCTTTGCCACGACTAAGGTCAACGAGAGCACTAATAGCCCAGACTTGCACTTACCAGCTGCACAGCAGAGCCTGCTGGCC
CTTCTTCTGGCGCCGATCAAGCACTACGTATCCATTTTCACTGCCCTGGCGTTGCCGACATACGTGCCTTTACTCCAGGC
ACAGACGTATCCGACAAGAAGAGCTGTGGCAGGAGAGGTGGCGCGCAGCCTGCTGAAGAACCAGACGAAGATCACGACAC
CCGAGCAGCTAGACAATGTTCTTGAGGTGCTAAAGGTCTTGATAACGGAGGGCTCACAGCAGCCGGCCGGCTATCCAGGG
GTGGCACAGCAGCAGAGGCCACGCACCTTCGAGACGGACGAGACGCTCGAAGAGCAAGGCTGGCTGGCCCGTCTGGTGCA
TCTCATAAACGCCGAGAAGAACGACACACAGTTCGTCTTGCTGCAGGCTTTGCGCAAAGCGTACGCCGACGGCAACGAGC
GCATCCGTATCACGACACCACCGCTGATCACGGCCGGCCTGAAGCTGGCCCGGCGGTTCAAGGCGCGCGAGCACTACGAA
GACAACTGGTCAACGCAGTCGTCGGCGCTGTACAAGTTCCTGCACTCGACCGTGTCCGCCCTGTATGCGCGTTTGAACAG
CGGTGGCGGAGCCGAGCTGGCGTTGAGGCTATTCTGCATGTGTGGGCAGACCGCCGATATTACCGGCTTCGAGGAGGTGG
CGTACGAATACTTCGCACAGGCATTCACCGTGTACGAGGAGGCCGTGTCAGACTCCAAGGCACAGTTCCAGGCGGTGACT
ATGATCGCCAGCACCCTGCACCAGACGCGCAACTTCAGTCGCGAAAACTACGACACCCTTATCACAAAGTGTGCACAGCA
CGCCAGTAAGCTGCTGCGCAAGCCCGACCAGTGTCGTGCGGTATACCTGGCCAGCCATTTGTGGTGGGCGACCCCGATCG
CGGCTAACGGCGAGACGGACGAGACCGATGTAAGTAAAAGCAATGCGACGGCGTGGGGTTTTGTGGAAGACCATGCAGGC
TGACTGGGTAGCTTTACCGAGACGGGAAGCGCGTGCTCGAGTGCTTGCAGCGAGCACTGCGGGTGGCCGACTCGTGCATG
GAGACGGCGACGTCGATCGAGCTGTTCGTGGAGATTCTGGACCGCTACGTGTACTATTTTGACCAACAGAATGAATCGGT
AAGTGCATTATGCAATGCGCACACATCACCATTACCCATCGGACAAAGCTGCTTGCTAACCTCTCTCGACTATGCAGGTC
ACGACCAAATACCTCAACGGTCTGATTGAACTGATCCACTCCAACTTGTCGAGCAACCAGCAGGAGTCGCCGTCTGTTGA
AGCCAGCAGAAAGCATTTCATGCACACACTGGAGCTGATTCGCAGTAAGGAGTACGAGGGCATTGTGCTTACGCCTAAAT
GA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62